This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -o /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_for_L001_R1_001.fastq.gz -p /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_for_L001_R2_001.fastq.gz /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//raw/for_L001_R1_001.fastq.gz /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//raw/for_L001_R2_001.fastq.gz -m 8 Processing reads on 1 core in paired-end mode ... No reads processed! This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -g pr_plasmid1=GAATCAGGGGATAACGCAGGAAAGAACATG -y {name} -g pr_plasmid2=AACAGCTATGACCATTACGCCAAGCTTGGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGT -y {name} -G pr_plasmid1=CATGTTCTTTCCTGCGTTATCCCCTGATTC -y {name} -G pr_plasmid2=ACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCCAAGCTTGGCGTAATGGTCATAGCTGTT -y {name} -o /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cut_barc_praimers_cutIL_for_L001_R1_001.fastq.gz -p /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cut_barc_praimers_cutIL_for_L001_R2_001.fastq.gz --overlap 20 /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_for_L001_R1_001.fastq.gz /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_for_L001_R2_001.fastq.gz Processing reads on 1 core in paired-end mode ... No reads processed! This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -o /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_file_L001_R1_001.fastq.gz -p /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_file_L001_R2_001.fastq.gz /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//raw/file_L001_R1_001.fastq.gz /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//raw/file_L001_R2_001.fastq.gz -m 8 Processing reads on 1 core in paired-end mode ... No reads processed! This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -g pr_plasmid1=GAATCAGGGGATAACGCAGGAAAGAACATG -y {name} -g pr_plasmid2=AACAGCTATGACCATTACGCCAAGCTTGGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGT -y {name} -G pr_plasmid1=CATGTTCTTTCCTGCGTTATCCCCTGATTC -y {name} -G pr_plasmid2=ACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCCAAGCTTGGCGTAATGGTCATAGCTGTT -y {name} -o /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cut_barc_praimers_cutIL_file_L001_R1_001.fastq.gz -p /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cut_barc_praimers_cutIL_file_L001_R2_001.fastq.gz --overlap 20 /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_file_L001_R1_001.fastq.gz /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_file_L001_R2_001.fastq.gz Processing reads on 1 core in paired-end mode ... No reads processed! This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -o /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_in_L001_R1_001.fastq.gz -p /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_in_L001_R2_001.fastq.gz /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//raw/in_L001_R1_001.fastq.gz /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//raw/in_L001_R2_001.fastq.gz -m 8 Processing reads on 1 core in paired-end mode ... No reads processed! This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -g pr_plasmid1=GAATCAGGGGATAACGCAGGAAAGAACATG -y {name} -g pr_plasmid2=AACAGCTATGACCATTACGCCAAGCTTGGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGT -y {name} -G pr_plasmid1=CATGTTCTTTCCTGCGTTATCCCCTGATTC -y {name} -G pr_plasmid2=ACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCCAAGCTTGGCGTAATGGTCATAGCTGTT -y {name} -o /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cut_barc_praimers_cutIL_in_L001_R1_001.fastq.gz -p /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cut_barc_praimers_cutIL_in_L001_R2_001.fastq.gz --overlap 20 /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_in_L001_R1_001.fastq.gz /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_in_L001_R2_001.fastq.gz Processing reads on 1 core in paired-end mode ... No reads processed! This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -o /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_103_S103_L001_R1_001.fastq.gz -p /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_103_S103_L001_R2_001.fastq.gz /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//raw/103_S103_L001_R1_001.fastq.gz /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//raw/103_S103_L001_R2_001.fastq.gz -m 8 Processing reads on 1 core in paired-end mode ... Finished in 8.59 s (68 us/read; 0.89 M reads/minute). === Summary === Total read pairs processed: 127,083 Read 1 with adapter: 28,786 (22.7%) Read 2 with adapter: 27,839 (21.9%) Pairs that were too short: 0 (0.0%) Pairs written (passing filters): 127,083 (100.0%) Total basepairs processed: 38,379,066 bp Read 1: 19,189,533 bp Read 2: 19,189,533 bp Total written (filtered): 37,833,166 bp (98.6%) Read 1: 18,908,361 bp Read 2: 18,924,805 bp === First read: Adapter 1 === Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 3'; Length: 34; Trimmed: 28786 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-34 bp: 3 Bases preceding removed adapters: A: 0.7% C: 97.6% G: 0.4% T: 1.3% none/other: 0.0% WARNING: The adapter is preceded by "C" extremely often. The provided adapter sequence could be incomplete at its 3' end. Overview of removed sequences length count expect max.err error counts 3 620 1985.7 0 620 4 203 496.4 0 203 5 231 124.1 0 231 6 6371 31.0 0 6371 7 1327 7.8 0 1327 8 253 1.9 0 253 9 341 0.5 0 328 13 10 13659 0.1 1 12691 968 11 2759 0.0 1 2243 516 12 463 0.0 1 399 64 13 169 0.0 1 151 18 14 115 0.0 1 92 23 15 755 0.0 1 663 92 16 287 0.0 1 225 62 17 108 0.0 1 96 12 18 120 0.0 1 97 22 1 19 134 0.0 1 117 17 20 91 0.0 2 80 11 21 140 0.0 2 118 18 4 22 109 0.0 2 88 20 1 23 88 0.0 2 70 13 5 24 79 0.0 2 60 16 3 25 17 0.0 2 15 2 26 6 0.0 2 5 1 27 3 0.0 2 0 3 28 6 0.0 2 5 1 29 6 0.0 2 4 2 30 7 0.0 3 5 2 31 107 0.0 3 84 19 3 1 32 53 0.0 3 38 10 3 2 33 29 0.0 3 20 9 34 4 0.0 3 4 35 6 0.0 3 4 2 36 7 0.0 3 5 1 1 37 1 0.0 3 0 1 38 3 0.0 3 3 39 1 0.0 3 1 40 10 0.0 3 10 41 2 0.0 3 1 0 1 42 3 0.0 3 1 2 43 1 0.0 3 1 44 2 0.0 3 2 45 3 0.0 3 2 1 46 3 0.0 3 3 47 1 0.0 3 1 48 4 0.0 3 3 1 49 1 0.0 3 1 50 2 0.0 3 2 52 3 0.0 3 0 2 0 1 53 3 0.0 3 3 54 6 0.0 3 6 55 2 0.0 3 2 56 2 0.0 3 1 1 58 2 0.0 3 1 1 59 1 0.0 3 1 60 1 0.0 3 1 61 1 0.0 3 1 62 2 0.0 3 2 63 4 0.0 3 4 65 1 0.0 3 1 66 3 0.0 3 3 68 1 0.0 3 1 69 4 0.0 3 4 71 2 0.0 3 1 1 72 1 0.0 3 1 73 3 0.0 3 2 1 74 1 0.0 3 1 75 3 0.0 3 2 1 77 4 0.0 3 2 2 78 1 0.0 3 1 80 3 0.0 3 2 1 85 2 0.0 3 2 87 1 0.0 3 1 88 1 0.0 3 1 90 5 0.0 3 5 92 4 0.0 3 4 93 3 0.0 3 3 94 1 0.0 3 1 95 1 0.0 3 1 97 1 0.0 3 1 98 2 0.0 3 2 104 1 0.0 3 1 === Second read: Adapter 2 === Sequence: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT; Type: regular 3'; Length: 58; Trimmed: 27839 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-58 bp: 5 Bases preceding removed adapters: A: 0.8% C: 0.9% G: 0.8% T: 97.4% none/other: 0.0% WARNING: The adapter is preceded by "T" extremely often. The provided adapter sequence could be incomplete at its 3' end. Overview of removed sequences length count expect max.err error counts 3 798 1985.7 0 798 4 230 496.4 0 230 5 243 124.1 0 243 6 6217 31.0 0 6217 7 1265 7.8 0 1265 8 255 1.9 0 255 9 331 0.5 0 320 11 10 13042 0.1 1 7215 5827 11 2632 0.0 1 2304 328 12 441 0.0 1 371 70 13 161 0.0 1 147 14 14 112 0.0 1 97 15 15 733 0.0 1 631 102 16 284 0.0 1 238 46 17 102 0.0 1 88 14 18 117 0.0 1 86 31 19 129 0.0 1 104 23 2 20 89 0.0 2 79 8 2 21 132 0.0 2 99 25 8 22 104 0.0 2 51 50 3 23 85 0.0 2 71 11 3 24 76 0.0 2 59 15 2 25 16 0.0 2 11 5 26 5 0.0 2 3 1 1 27 3 0.0 2 2 0 1 28 6 0.0 2 0 1 1 4 29 4 0.0 2 3 0 1 30 9 0.0 3 3 6 31 105 0.0 3 74 25 3 3 32 51 0.0 3 34 13 3 1 33 28 0.0 3 21 6 1 34 4 0.0 3 3 0 0 1 35 6 0.0 3 0 0 6 36 7 0.0 3 0 4 2 1 37 1 0.0 3 0 1 38 3 0.0 3 0 2 1 39 1 0.0 3 0 0 0 0 1 40 9 0.0 4 0 0 0 9 41 1 0.0 4 0 0 0 1 42 2 0.0 4 0 0 0 0 2 WARNING: One or more of your adapter sequences may be incomplete. Please see the detailed output above. This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -g pr_plasmid1=GAATCAGGGGATAACGCAGGAAAGAACATG -y {name} -g pr_plasmid2=AACAGCTATGACCATTACGCCAAGCTTGGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGT -y {name} -G pr_plasmid1=CATGTTCTTTCCTGCGTTATCCCCTGATTC -y {name} -G pr_plasmid2=ACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCCAAGCTTGGCGTAATGGTCATAGCTGTT -y {name} -o /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cut_barc_praimers_cutIL_103_S103_L001_R1_001.fastq.gz -p /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cut_barc_praimers_cutIL_103_S103_L001_R2_001.fastq.gz --overlap 20 /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_103_S103_L001_R1_001.fastq.gz /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_103_S103_L001_R2_001.fastq.gz Processing reads on 1 core in paired-end mode ... Finished in 16.60 s (131 us/read; 0.46 M reads/minute). === Summary === Total read pairs processed: 127,083 Read 1 with adapter: 126,285 (99.4%) Read 2 with adapter: 29,316 (23.1%) Pairs written (passing filters): 127,083 (100.0%) Total basepairs processed: 37,833,166 bp Read 1: 18,908,361 bp Read 2: 18,924,805 bp Total written (filtered): 21,432,374 bp (56.6%) Read 1: 6,665,380 bp Read 2: 14,766,994 bp === First read: Adapter pr_plasmid1 === Sequence: GAATCAGGGGATAACGCAGGAAAGAACATG; Type: regular 5'; Length: 30; Trimmed: 0 times. === First read: Adapter pr_plasmid2 === Sequence: AACAGCTATGACCATTACGCCAAGCTTGGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGT; Type: regular 5'; Length: 97; Trimmed: 126285 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-59 bp: 5; 60-69 bp: 6; 70-79 bp: 7; 80-89 bp: 8; 90-97 bp: 9 Overview of removed sequences length count expect max.err error counts 89 1 0.0 8 0 0 0 0 0 0 0 0 1 90 1 0.0 9 0 0 0 0 0 0 0 0 0 1 91 1 0.0 9 0 0 0 0 0 0 0 0 0 1 92 2 0.0 9 0 1 0 1 93 12 0.0 9 0 0 2 0 6 0 0 2 0 2 94 117 0.0 9 0 1 13 70 20 7 5 0 1 95 1019 0.0 9 10 132 557 197 65 23 15 8 6 6 96 10829 0.0 9 699 6387 2480 685 246 119 81 50 43 39 97 110835 0.0 9 72021 27284 7114 2199 999 546 294 200 107 71 98 2316 0.0 9 162 1037 507 222 141 90 56 37 36 28 99 494 0.0 9 0 2 139 181 75 41 34 8 10 4 100 180 0.0 9 0 0 1 63 37 27 16 13 11 12 101 102 0.0 9 0 0 0 0 21 28 18 15 12 8 102 177 0.0 9 0 0 0 0 0 73 42 35 15 12 103 46 0.0 9 0 0 0 0 0 0 16 13 11 6 104 38 0.0 9 0 0 0 0 0 0 0 19 12 7 105 81 0.0 9 0 0 0 0 0 0 0 0 50 31 106 34 0.0 9 0 0 0 0 0 0 0 0 0 34 === Second read: Adapter pr_plasmid1 === Sequence: CATGTTCTTTCCTGCGTTATCCCCTGATTC; Type: regular 5'; Length: 30; Trimmed: 0 times. === Second read: Adapter pr_plasmid2 === Sequence: ACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCCAAGCTTGGCGTAATGGTCATAGCTGTT; Type: regular 5'; Length: 97; Trimmed: 29316 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-59 bp: 5; 60-69 bp: 6; 70-79 bp: 7; 80-89 bp: 8; 90-97 bp: 9 Overview of removed sequences length count expect max.err error counts 110 1 0.0 9 0 0 0 0 0 0 1 113 1 0.0 9 0 0 0 0 0 0 0 1 116 3 0.0 9 0 0 2 0 0 0 0 1 117 4 0.0 9 0 1 1 2 118 22 0.0 9 1 4 10 2 2 2 0 0 0 1 119 47 0.0 9 0 0 22 18 6 1 120 101 0.0 9 0 1 67 17 8 4 1 1 0 2 121 7 0.0 9 1 1 3 1 0 0 0 0 1 122 4 0.0 9 2 1 0 0 0 0 0 0 0 1 123 2 0.0 9 0 0 1 0 0 1 124 2 0.0 9 1 1 125 3 0.0 9 1 0 1 0 0 0 0 1 126 16 0.0 9 4 7 4 1 127 74 0.0 9 35 27 6 3 2 0 1 128 81 0.0 9 36 25 13 2 0 0 2 1 1 1 129 102 0.0 9 49 30 13 6 1 3 130 135 0.0 9 76 37 10 3 1 2 1 5 131 86 0.0 9 45 28 8 2 1 0 1 0 0 1 132 126 0.0 9 66 39 9 6 3 2 1 133 115 0.0 9 62 34 9 4 2 3 0 0 1 134 104 0.0 9 46 32 15 7 1 2 1 135 293 0.0 9 120 99 41 11 8 6 2 5 0 1 136 738 0.0 9 409 199 67 22 16 8 7 4 3 3 137 111 0.0 9 45 38 13 5 1 4 1 2 0 2 138 164 0.0 9 55 46 28 17 10 1 1 1 3 2 139 455 0.0 9 99 151 128 51 14 6 3 2 0 1 140 2718 0.0 9 804 1126 471 143 72 40 25 17 13 7 141 13443 0.0 9 7886 3497 1118 405 196 118 79 68 47 29 142 311 0.0 9 100 120 48 18 11 9 3 0 2 143 268 0.0 9 70 95 64 20 5 4 2 6 1 1 144 1403 0.0 9 422 594 217 66 38 27 15 16 3 5 145 6558 0.0 9 3828 1762 545 171 102 50 35 28 21 16 146 207 0.0 9 70 85 33 7 5 1 3 2 1 147 124 0.0 9 64 41 12 2 1 1 1 0 0 2 148 139 0.0 9 74 33 16 5 3 2 0 1 3 2 149 131 0.0 9 67 36 15 4 4 3 1 1 150 86 0.0 9 45 24 9 2 1 1 1 2 0 1 151 1131 0.0 9 52 66 72 98 185 136 126 142 121 133 This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -o /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_104_S104_L001_R1_001.fastq.gz -p /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_104_S104_L001_R2_001.fastq.gz /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//raw/104_S104_L001_R1_001.fastq.gz /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//raw/104_S104_L001_R2_001.fastq.gz -m 8 Processing reads on 1 core in paired-end mode ... Finished in 9.40 s (62 us/read; 0.97 M reads/minute). === Summary === Total read pairs processed: 152,683 Read 1 with adapter: 35,537 (23.3%) Read 2 with adapter: 34,236 (22.4%) Pairs that were too short: 0 (0.0%) Pairs written (passing filters): 152,683 (100.0%) Total basepairs processed: 46,110,266 bp Read 1: 23,055,133 bp Read 2: 23,055,133 bp Total written (filtered): 45,440,513 bp (98.5%) Read 1: 22,709,955 bp Read 2: 22,730,558 bp === First read: Adapter 1 === Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 3'; Length: 34; Trimmed: 35537 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-34 bp: 3 Bases preceding removed adapters: A: 0.8% C: 97.4% G: 0.6% T: 1.2% none/other: 0.0% WARNING: The adapter is preceded by "C" extremely often. The provided adapter sequence could be incomplete at its 3' end. Overview of removed sequences length count expect max.err error counts 3 667 2385.7 0 667 4 276 596.4 0 276 5 245 149.1 0 245 6 7780 37.3 0 7780 7 1606 9.3 0 1606 8 308 2.3 0 308 9 395 0.6 0 382 13 10 17200 0.1 1 15922 1278 11 3567 0.0 1 2837 730 12 580 0.0 1 505 75 13 188 0.0 1 161 27 14 137 0.0 1 105 32 15 818 0.0 1 730 88 16 326 0.0 1 263 63 17 163 0.0 1 144 19 18 182 0.0 1 164 18 19 135 0.0 1 120 15 20 129 0.0 2 107 19 3 21 164 0.0 2 133 28 3 22 124 0.0 2 105 15 4 23 112 0.0 2 91 14 7 24 89 0.0 2 80 9 25 19 0.0 2 17 2 26 9 0.0 2 7 2 27 5 0.0 2 4 1 28 5 0.0 2 4 0 1 29 8 0.0 2 6 2 30 13 0.0 3 12 1 31 80 0.0 3 63 15 1 1 32 34 0.0 3 29 5 33 22 0.0 3 19 3 34 11 0.0 3 9 2 35 5 0.0 3 4 1 37 4 0.0 3 4 38 3 0.0 3 3 39 3 0.0 3 2 0 1 40 3 0.0 3 2 1 41 4 0.0 3 2 2 42 4 0.0 3 4 43 2 0.0 3 2 44 3 0.0 3 2 0 1 45 2 0.0 3 1 1 46 1 0.0 3 0 1 47 5 0.0 3 3 2 48 4 0.0 3 1 3 49 1 0.0 3 0 0 0 1 50 4 0.0 3 3 1 51 4 0.0 3 2 2 52 3 0.0 3 1 2 53 6 0.0 3 6 54 2 0.0 3 2 55 7 0.0 3 4 2 1 56 2 0.0 3 1 1 57 3 0.0 3 3 58 2 0.0 3 2 59 1 0.0 3 1 60 1 0.0 3 1 61 4 0.0 3 2 2 62 4 0.0 3 3 1 63 4 0.0 3 3 1 65 2 0.0 3 2 67 3 0.0 3 3 69 1 0.0 3 1 70 3 0.0 3 3 71 1 0.0 3 1 73 3 0.0 3 1 1 1 74 2 0.0 3 0 2 76 1 0.0 3 1 77 1 0.0 3 1 79 2 0.0 3 2 80 2 0.0 3 1 1 81 1 0.0 3 0 1 82 1 0.0 3 1 84 2 0.0 3 1 1 85 2 0.0 3 1 1 86 2 0.0 3 1 0 1 87 2 0.0 3 1 1 88 1 0.0 3 1 90 6 0.0 3 4 1 1 91 3 0.0 3 3 94 2 0.0 3 1 1 95 2 0.0 3 1 1 97 1 0.0 3 1 99 1 0.0 3 1 101 2 0.0 3 2 === Second read: Adapter 2 === Sequence: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT; Type: regular 3'; Length: 58; Trimmed: 34236 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-58 bp: 5 Bases preceding removed adapters: A: 0.9% C: 0.8% G: 0.8% T: 97.4% none/other: 0.0% WARNING: The adapter is preceded by "T" extremely often. The provided adapter sequence could be incomplete at its 3' end. Overview of removed sequences length count expect max.err error counts 3 928 2385.7 0 928 4 265 596.4 0 265 5 256 149.1 0 256 6 7492 37.3 0 7492 7 1535 9.3 0 1535 8 310 2.3 0 310 9 370 0.6 0 361 9 10 16398 0.1 1 9260 7138 11 3410 0.0 1 2989 421 12 539 0.0 1 453 86 13 174 0.0 1 151 23 14 137 0.0 1 115 22 15 798 0.0 1 699 99 16 322 0.0 1 272 50 17 157 0.0 1 142 15 18 183 0.0 1 154 29 19 134 0.0 1 109 24 1 20 126 0.0 2 102 17 7 21 157 0.0 2 118 30 9 22 122 0.0 2 66 50 6 23 109 0.0 2 88 20 1 24 88 0.0 2 68 17 3 25 19 0.0 2 11 8 26 9 0.0 2 9 27 5 0.0 2 4 1 28 5 0.0 2 2 1 1 1 29 8 0.0 2 7 0 1 30 13 0.0 3 7 6 31 79 0.0 3 61 12 4 2 32 33 0.0 3 19 14 33 22 0.0 3 16 3 2 1 34 11 0.0 3 7 4 35 5 0.0 3 0 1 3 1 37 4 0.0 3 0 3 1 38 3 0.0 3 0 2 1 39 2 0.0 3 0 0 0 0 2 40 2 0.0 4 0 0 0 2 41 3 0.0 4 0 0 0 3 42 3 0.0 4 0 0 0 0 3 WARNING: One or more of your adapter sequences may be incomplete. Please see the detailed output above. This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -g pr_plasmid1=GAATCAGGGGATAACGCAGGAAAGAACATG -y {name} -g pr_plasmid2=AACAGCTATGACCATTACGCCAAGCTTGGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGT -y {name} -G pr_plasmid1=CATGTTCTTTCCTGCGTTATCCCCTGATTC -y {name} -G pr_plasmid2=ACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCCAAGCTTGGCGTAATGGTCATAGCTGTT -y {name} -o /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cut_barc_praimers_cutIL_104_S104_L001_R1_001.fastq.gz -p /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cut_barc_praimers_cutIL_104_S104_L001_R2_001.fastq.gz --overlap 20 /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_104_S104_L001_R1_001.fastq.gz /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_104_S104_L001_R2_001.fastq.gz Processing reads on 1 core in paired-end mode ... Finished in 20.14 s (132 us/read; 0.45 M reads/minute). === Summary === Total read pairs processed: 152,683 Read 1 with adapter: 151,479 (99.2%) Read 2 with adapter: 36,117 (23.7%) Pairs written (passing filters): 152,683 (100.0%) Total basepairs processed: 45,440,513 bp Read 1: 22,709,955 bp Read 2: 22,730,558 bp Total written (filtered): 25,631,972 bp (56.4%) Read 1: 8,024,684 bp Read 2: 17,607,288 bp === First read: Adapter pr_plasmid1 === Sequence: GAATCAGGGGATAACGCAGGAAAGAACATG; Type: regular 5'; Length: 30; Trimmed: 0 times. === First read: Adapter pr_plasmid2 === Sequence: AACAGCTATGACCATTACGCCAAGCTTGGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGT; Type: regular 5'; Length: 97; Trimmed: 151479 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-59 bp: 5; 60-69 bp: 6; 70-79 bp: 7; 80-89 bp: 8; 90-97 bp: 9 Overview of removed sequences length count expect max.err error counts 89 5 0.0 8 0 0 0 0 0 0 0 0 1 4 90 3 0.0 9 0 0 0 0 0 0 0 0 1 2 91 3 0.0 9 0 0 0 0 0 0 1 0 1 1 92 2 0.0 9 0 0 1 0 0 0 0 1 93 16 0.0 9 0 0 0 3 5 2 1 1 2 2 94 120 0.0 9 3 4 12 60 19 7 2 6 4 3 95 1180 0.0 9 9 144 633 252 72 28 15 8 6 13 96 13285 0.0 9 925 7742 2952 904 286 153 112 97 62 52 97 132554 0.0 9 85391 32265 8537 2981 1414 820 494 327 189 136 98 2895 0.0 9 195 1242 600 321 176 130 81 59 48 43 99 623 0.0 9 1 5 179 180 98 48 41 33 22 16 100 254 0.0 9 0 0 1 80 45 48 24 31 14 11 101 94 0.0 9 0 0 0 0 25 17 22 12 8 10 102 248 0.0 9 0 0 0 0 0 98 68 41 18 23 103 61 0.0 9 0 0 0 0 0 1 18 17 13 12 104 41 0.0 9 0 0 0 0 0 0 0 13 19 9 105 62 0.0 9 0 0 0 0 0 0 0 0 38 24 106 32 0.0 9 0 0 0 0 0 0 0 0 0 32 107 1 0.0 9 0 0 0 0 0 0 0 0 0 1 === Second read: Adapter pr_plasmid1 === Sequence: CATGTTCTTTCCTGCGTTATCCCCTGATTC; Type: regular 5'; Length: 30; Trimmed: 0 times. === Second read: Adapter pr_plasmid2 === Sequence: ACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCCAAGCTTGGCGTAATGGTCATAGCTGTT; Type: regular 5'; Length: 97; Trimmed: 36117 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-59 bp: 5; 60-69 bp: 6; 70-79 bp: 7; 80-89 bp: 8; 90-97 bp: 9 Overview of removed sequences length count expect max.err error counts 104 1 0.0 9 0 0 0 0 0 0 0 0 0 1 106 1 0.0 9 0 0 0 0 0 0 0 0 1 108 1 0.0 9 0 0 0 0 0 0 0 0 0 1 109 1 0.0 9 0 0 0 0 0 0 1 112 1 0.0 9 0 0 0 0 0 1 114 1 0.0 9 0 0 0 0 1 115 1 0.0 9 0 0 0 0 1 116 3 0.0 9 0 0 1 0 0 1 1 117 7 0.0 9 0 0 4 1 2 118 17 0.0 9 2 6 1 5 2 0 0 0 0 1 119 31 0.0 9 0 0 15 10 3 1 1 0 1 120 76 0.0 9 0 1 50 16 4 3 2 121 10 0.0 9 1 4 3 1 0 0 0 0 1 122 6 0.0 9 2 3 1 123 4 0.0 9 1 0 0 1 0 0 1 1 124 3 0.0 9 0 0 1 0 1 0 1 125 7 0.0 9 0 2 3 1 1 126 18 0.0 9 3 7 3 4 0 0 0 0 0 1 127 87 0.0 9 49 24 4 2 4 3 1 128 104 0.0 9 43 33 16 4 2 3 1 1 0 1 129 118 0.0 9 60 38 11 5 1 0 0 1 1 1 130 158 0.0 9 89 43 11 8 1 3 0 1 2 131 119 0.0 9 69 27 9 3 6 1 1 2 1 132 126 0.0 9 70 33 7 8 4 0 1 1 1 1 133 181 0.0 9 103 50 14 7 1 3 0 0 1 2 134 155 0.0 9 88 34 22 3 3 4 0 0 1 135 328 0.0 9 131 114 43 16 9 9 2 0 3 1 136 792 0.0 9 467 197 73 22 11 9 5 5 3 137 140 0.0 9 66 33 20 9 9 3 138 172 0.0 9 70 43 22 20 7 4 0 1 4 1 139 563 0.0 9 139 168 143 52 25 12 9 9 3 3 140 3518 0.0 9 975 1466 593 230 101 51 34 31 20 17 141 16892 0.0 9 9871 4254 1436 543 295 166 128 94 63 42 142 350 0.0 9 101 126 66 32 14 5 3 1 2 143 331 0.0 9 86 101 82 36 9 4 5 3 3 2 144 1706 0.0 9 485 702 298 103 46 24 13 19 11 5 145 7940 0.0 9 4627 2074 647 241 127 75 59 43 30 17 146 208 0.0 9 70 80 35 11 5 3 3 1 147 129 0.0 9 62 37 15 4 1 1 1 1 3 4 148 138 0.0 9 62 35 14 12 0 4 3 2 3 3 149 164 0.0 9 90 46 11 6 3 0 1 1 4 2 150 120 0.0 9 55 37 11 2 1 3 3 1 2 5 151 1389 0.0 9 61 109 99 118 221 175 132 149 158 167 This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -o /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_105_S105_L001_R1_001.fastq.gz -p /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_105_S105_L001_R2_001.fastq.gz /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//raw/105_S105_L001_R1_001.fastq.gz /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//raw/105_S105_L001_R2_001.fastq.gz -m 8 Processing reads on 1 core in paired-end mode ... Finished in 8.43 s (70 us/read; 0.85 M reads/minute). === Summary === Total read pairs processed: 119,527 Read 1 with adapter: 67,409 (56.4%) Read 2 with adapter: 61,145 (51.2%) Pairs that were too short: 0 (0.0%) Pairs written (passing filters): 119,527 (100.0%) Total basepairs processed: 36,097,154 bp Read 1: 18,048,577 bp Read 2: 18,048,577 bp Total written (filtered): 34,594,741 bp (95.8%) Read 1: 17,135,582 bp Read 2: 17,459,159 bp === First read: Adapter 1 === Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 3'; Length: 34; Trimmed: 67409 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-34 bp: 3 Bases preceding removed adapters: A: 0.2% C: 99.0% G: 0.1% T: 0.7% none/other: 0.0% WARNING: The adapter is preceded by "C" extremely often. The provided adapter sequence could be incomplete at its 3' end. Overview of removed sequences length count expect max.err error counts 3 343 1867.6 0 343 4 269 466.9 0 269 5 473 116.7 0 473 6 16117 29.2 0 16117 7 3394 7.3 0 3394 8 569 1.8 0 569 9 760 0.5 0 731 29 10 28348 0.1 1 26288 2060 11 6071 0.0 1 4987 1084 12 1082 0.0 1 941 141 13 286 0.0 1 254 32 14 223 0.0 1 171 52 15 1535 0.0 1 1366 169 16 744 0.0 1 570 174 17 370 0.0 1 334 36 18 397 0.0 1 346 48 3 19 301 0.0 1 256 44 1 20 323 0.0 2 263 52 8 21 411 0.0 2 349 49 13 22 320 0.0 2 255 55 10 23 203 0.0 2 162 30 11 24 186 0.0 2 154 27 5 25 51 0.0 2 39 12 26 37 0.0 2 28 8 1 27 37 0.0 2 28 3 6 28 34 0.0 2 22 9 3 29 43 0.0 2 35 7 0 1 30 27 0.0 3 23 4 31 120 0.0 3 99 16 4 1 32 65 0.0 3 55 8 2 33 43 0.0 3 21 19 3 34 28 0.0 3 19 6 2 1 35 52 0.0 3 35 12 4 1 36 29 0.0 3 24 4 1 37 25 0.0 3 20 4 1 38 42 0.0 3 33 8 1 39 41 0.0 3 31 9 1 40 43 0.0 3 33 10 41 45 0.0 3 27 16 2 42 34 0.0 3 26 7 1 43 47 0.0 3 32 14 1 44 36 0.0 3 28 6 2 45 27 0.0 3 18 6 3 46 44 0.0 3 34 10 47 37 0.0 3 26 7 4 48 50 0.0 3 30 15 4 1 49 51 0.0 3 33 12 5 1 50 59 0.0 3 46 10 2 1 51 49 0.0 3 35 12 2 52 37 0.0 3 26 10 1 53 48 0.0 3 33 11 3 1 54 52 0.0 3 36 14 2 55 62 0.0 3 44 13 4 1 56 35 0.0 3 25 7 3 57 65 0.0 3 46 17 0 2 58 50 0.0 3 34 14 2 59 56 0.0 3 41 13 1 1 60 29 0.0 3 19 9 1 61 50 0.0 3 32 13 4 1 62 62 0.0 3 45 13 4 63 49 0.0 3 28 17 4 64 51 0.0 3 38 12 1 65 54 0.0 3 41 10 2 1 66 48 0.0 3 39 7 2 67 65 0.0 3 42 19 3 1 68 65 0.0 3 39 24 1 1 69 57 0.0 3 39 13 4 1 70 70 0.0 3 49 17 4 71 87 0.0 3 56 26 5 72 78 0.0 3 50 21 6 1 73 62 0.0 3 43 13 6 74 81 0.0 3 62 14 2 3 75 61 0.0 3 44 13 3 1 76 83 0.0 3 55 22 6 77 80 0.0 3 64 14 2 78 109 0.0 3 78 24 6 1 79 76 0.0 3 54 19 2 1 80 104 0.0 3 74 24 5 1 81 67 0.0 3 47 16 4 82 87 0.0 3 58 23 6 83 85 0.0 3 63 20 2 84 116 0.0 3 87 19 8 2 85 54 0.0 3 37 13 2 2 86 74 0.0 3 48 25 0 1 87 85 0.0 3 57 24 4 88 92 0.0 3 68 16 7 1 89 71 0.0 3 54 12 3 2 90 58 0.0 3 45 9 4 91 71 0.0 3 51 19 1 92 123 0.0 3 95 20 6 2 93 59 0.0 3 40 12 5 2 94 59 0.0 3 47 10 1 1 95 56 0.0 3 37 12 5 2 96 37 0.0 3 30 6 1 97 81 0.0 3 55 20 5 1 98 70 0.0 3 51 15 2 2 99 48 0.0 3 34 11 3 100 42 0.0 3 36 5 1 101 65 0.0 3 50 13 2 102 65 0.0 3 42 18 5 103 74 0.0 3 59 12 2 1 104 20 0.0 3 14 4 1 1 105 2 0.0 3 1 1 106 1 0.0 3 1 === Second read: Adapter 2 === Sequence: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT; Type: regular 3'; Length: 58; Trimmed: 61145 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-58 bp: 5 Bases preceding removed adapters: A: 0.4% C: 0.2% G: 0.2% T: 99.2% none/other: 0.0% WARNING: The adapter is preceded by "T" extremely often. The provided adapter sequence could be incomplete at its 3' end. Overview of removed sequences length count expect max.err error counts 3 534 1867.6 0 534 4 342 466.9 0 342 5 523 116.7 0 523 6 15610 29.2 0 15610 7 3213 7.3 0 3213 8 555 1.8 0 555 9 744 0.5 0 729 15 10 26946 0.1 1 14975 11971 11 5837 0.0 1 5196 641 12 1025 0.0 1 859 166 13 275 0.0 1 245 30 14 214 0.0 1 174 40 15 1505 0.0 1 1308 197 16 733 0.0 1 620 113 17 364 0.0 1 300 64 18 388 0.0 1 323 62 3 19 294 0.0 1 232 58 4 20 310 0.0 2 249 54 7 21 399 0.0 2 297 80 22 22 305 0.0 2 142 151 12 23 197 0.0 2 142 44 11 24 178 0.0 2 135 35 8 25 50 0.0 2 35 9 6 26 33 0.0 2 23 7 3 27 35 0.0 2 26 5 4 28 32 0.0 2 4 5 4 19 29 41 0.0 2 29 10 2 30 27 0.0 3 10 17 31 118 0.0 3 79 24 9 6 32 64 0.0 3 34 24 4 2 33 41 0.0 3 27 12 2 34 29 0.0 3 19 4 6 35 47 0.0 3 0 3 3 41 36 28 0.0 3 0 0 1 27 37 21 0.0 3 0 0 0 6 15 38 29 0.0 3 0 0 0 1 28 39 30 0.0 3 0 0 0 29 1 40 29 0.0 4 0 0 0 29 WARNING: One or more of your adapter sequences may be incomplete. Please see the detailed output above. This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -g pr_plasmid1=GAATCAGGGGATAACGCAGGAAAGAACATG -y {name} -g pr_plasmid2=AACAGCTATGACCATTACGCCAAGCTTGGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGT -y {name} -G pr_plasmid1=CATGTTCTTTCCTGCGTTATCCCCTGATTC -y {name} -G pr_plasmid2=ACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCCAAGCTTGGCGTAATGGTCATAGCTGTT -y {name} -o /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cut_barc_praimers_cutIL_105_S105_L001_R1_001.fastq.gz -p /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cut_barc_praimers_cutIL_105_S105_L001_R2_001.fastq.gz --overlap 20 /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_105_S105_L001_R1_001.fastq.gz /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_105_S105_L001_R2_001.fastq.gz Processing reads on 1 core in paired-end mode ... Finished in 15.27 s (128 us/read; 0.47 M reads/minute). === Summary === Total read pairs processed: 119,527 Read 1 with adapter: 113,697 (95.1%) Read 2 with adapter: 64,633 (54.1%) Pairs written (passing filters): 119,527 (100.0%) Total basepairs processed: 34,594,741 bp Read 1: 17,135,582 bp Read 2: 17,459,159 bp Total written (filtered): 14,405,195 bp (41.6%) Read 1: 6,115,438 bp Read 2: 8,289,757 bp === First read: Adapter pr_plasmid1 === Sequence: GAATCAGGGGATAACGCAGGAAAGAACATG; Type: regular 5'; Length: 30; Trimmed: 0 times. === First read: Adapter pr_plasmid2 === Sequence: AACAGCTATGACCATTACGCCAAGCTTGGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGT; Type: regular 5'; Length: 97; Trimmed: 113697 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-59 bp: 5; 60-69 bp: 6; 70-79 bp: 7; 80-89 bp: 8; 90-97 bp: 9 Overview of removed sequences length count expect max.err error counts 88 1 0.0 8 0 0 0 0 0 0 0 0 0 1 89 10 0.0 8 0 0 0 0 0 0 0 0 4 6 90 3 0.0 9 0 0 0 0 0 0 0 0 2 1 91 12 0.0 9 0 0 0 0 0 0 2 4 0 6 92 13 0.0 9 0 0 0 0 0 1 2 2 1 7 93 22 0.0 9 1 2 1 3 3 3 2 2 1 4 94 112 0.0 9 4 4 21 48 16 3 6 1 4 5 95 1061 0.0 9 11 126 627 202 51 17 10 6 2 9 96 11093 0.0 9 792 6982 2349 555 174 96 50 38 38 19 97 98618 0.0 9 67890 22536 5050 1527 715 382 228 141 82 67 98 1729 0.0 9 165 808 330 155 91 65 40 37 28 10 99 548 0.0 9 0 1 191 165 69 44 30 28 12 8 100 154 0.0 9 0 0 0 60 30 10 27 9 8 10 101 44 0.0 9 0 0 0 0 10 5 14 10 1 4 102 90 0.0 9 0 0 0 0 1 40 17 17 7 8 103 34 0.0 9 0 0 0 0 0 0 10 12 7 5 104 32 0.0 9 0 0 0 0 0 0 0 15 6 11 105 93 0.0 9 0 0 0 0 0 0 0 0 57 36 106 26 0.0 9 0 0 0 0 0 0 0 0 0 26 145 1 0.0 9 0 1 151 1 0.0 9 0 1 === Second read: Adapter pr_plasmid1 === Sequence: CATGTTCTTTCCTGCGTTATCCCCTGATTC; Type: regular 5'; Length: 30; Trimmed: 0 times. === Second read: Adapter pr_plasmid2 === Sequence: ACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCCAAGCTTGGCGTAATGGTCATAGCTGTT; Type: regular 5'; Length: 97; Trimmed: 64633 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-59 bp: 5; 60-69 bp: 6; 70-79 bp: 7; 80-89 bp: 8; 90-97 bp: 9 Overview of removed sequences length count expect max.err error counts 99 2 0.0 9 0 0 0 0 0 0 0 0 0 2 100 1 0.0 9 0 0 0 0 0 0 0 0 0 1 104 6 0.0 9 0 0 0 0 0 0 0 0 0 6 105 4 0.0 9 0 0 0 0 0 0 0 0 1 3 106 1 0.0 9 0 0 0 0 0 0 0 0 1 107 1 0.0 9 0 0 0 0 0 0 1 108 1 0.0 9 0 0 0 0 0 0 1 109 2 0.0 9 0 0 0 0 0 2 110 5 0.0 9 0 0 0 0 1 0 0 2 0 2 112 4 0.0 9 0 0 0 0 0 1 1 2 113 4 0.0 9 0 0 0 0 0 0 4 114 3 0.0 9 0 0 0 0 0 1 0 2 115 1 0.0 9 0 0 0 0 0 1 116 3 0.0 9 0 0 2 0 1 117 6 0.0 9 1 0 2 0 2 0 0 1 118 19 0.0 9 0 6 7 3 3 119 36 0.0 9 0 0 16 10 3 2 2 1 1 1 120 95 0.0 9 0 0 62 18 3 4 3 1 3 1 121 13 0.0 9 2 0 4 0 1 1 1 1 2 1 122 14 0.0 9 6 6 0 0 0 1 0 1 123 8 0.0 9 1 1 5 0 0 0 0 0 0 1 124 13 0.0 9 2 9 1 1 125 15 0.0 9 4 2 4 0 0 0 1 1 1 2 126 38 0.0 9 8 16 8 0 1 3 1 1 127 165 0.0 9 97 39 9 12 3 1 3 0 0 1 128 175 0.0 9 110 37 17 5 3 1 1 0 0 1 129 291 0.0 9 146 93 36 6 1 3 1 2 1 2 130 370 0.0 9 209 98 38 12 3 2 2 5 0 1 131 289 0.0 9 155 79 34 11 1 3 1 3 0 2 132 229 0.0 9 132 68 11 6 3 3 1 1 1 3 133 375 0.0 9 193 122 38 7 5 6 1 1 1 1 134 360 0.0 9 203 87 43 12 5 1 3 3 2 1 135 729 0.0 9 318 235 98 37 12 14 5 4 2 4 136 1504 0.0 9 902 382 115 47 24 10 7 9 6 2 137 194 0.0 9 96 57 20 8 5 4 1 3 138 258 0.0 9 93 72 34 31 15 4 2 2 4 1 139 1040 0.0 9 267 268 322 109 33 14 12 9 3 3 140 5993 0.0 9 1683 2681 987 301 132 74 56 30 29 20 141 27797 0.0 9 17099 6896 2035 748 377 239 155 101 89 58 142 692 0.0 9 241 253 109 49 18 10 3 6 1 2 143 590 0.0 9 154 177 154 55 15 12 12 2 5 4 144 3561 0.0 9 996 1592 557 216 90 47 24 17 11 11 145 16472 0.0 9 10124 4120 1224 414 223 124 92 63 57 31 146 436 0.0 9 188 150 58 14 10 4 4 4 3 1 147 250 0.0 9 123 75 18 13 12 2 2 1 3 1 148 203 0.0 9 99 52 22 12 7 5 2 1 2 1 149 219 0.0 9 120 50 23 2 3 3 7 5 4 2 150 181 0.0 9 80 50 23 6 4 4 7 2 2 3 151 1965 0.0 9 98 143 144 146 305 302 218 223 183 203