This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -o /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_106_S106_L001_R1_001.fastq.gz -p /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_106_S106_L001_R2_001.fastq.gz /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//raw/106_S106_L001_R1_001.fastq.gz /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//raw/106_S106_L001_R2_001.fastq.gz -m 8 Processing reads on 1 core in paired-end mode ... Finished in 6.95 s (85 us/read; 0.71 M reads/minute). === Summary === Total read pairs processed: 82,037 Read 1 with adapter: 70,290 (85.7%) Read 2 with adapter: 2,309 (2.8%) Pairs that were too short: 0 (0.0%) Pairs written (passing filters): 82,037 (100.0%) Total basepairs processed: 24,775,174 bp Read 1: 12,387,587 bp Read 2: 12,387,587 bp Total written (filtered): 20,461,224 bp (82.6%) Read 1: 8,110,983 bp Read 2: 12,350,241 bp === First read: Adapter 1 === Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 3'; Length: 34; Trimmed: 70290 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-34 bp: 3 Bases preceding removed adapters: A: 1.6% C: 0.2% G: 97.9% T: 0.4% none/other: 0.0% WARNING: The adapter is preceded by "G" extremely often. The provided adapter sequence could be incomplete at its 3' end. Overview of removed sequences length count expect max.err error counts 3 99 1281.8 0 99 4 36 320.5 0 36 5 36 80.1 0 36 6 38 20.0 0 38 7 39 5.0 0 39 8 38 1.3 0 38 9 28 0.3 0 27 1 10 82 0.1 1 78 4 11 43 0.0 1 38 5 12 63 0.0 1 57 6 13 42 0.0 1 37 5 14 50 0.0 1 42 8 15 51 0.0 1 40 11 16 81 0.0 1 70 11 17 70 0.0 1 63 7 18 60 0.0 1 54 5 1 19 82 0.0 1 68 13 1 20 36 0.0 2 32 4 21 65 0.0 2 49 13 3 22 47 0.0 2 36 11 23 54 0.0 2 43 8 3 24 61 0.0 2 51 9 1 25 44 0.0 2 34 7 3 26 98 0.0 2 71 24 3 27 49 0.0 2 39 9 1 28 55 0.0 2 46 8 1 29 40 0.0 2 29 9 1 1 30 39 0.0 3 31 7 1 31 42 0.0 3 31 10 1 32 41 0.0 3 29 10 2 33 30 0.0 3 18 9 2 1 34 34 0.0 3 26 7 0 1 35 39 0.0 3 28 9 2 36 36 0.0 3 25 9 2 37 34 0.0 3 29 4 1 38 35 0.0 3 33 2 39 37 0.0 3 26 9 2 40 56 0.0 3 45 8 3 41 50 0.0 3 39 9 2 42 32 0.0 3 25 5 2 43 48 0.0 3 34 12 2 44 40 0.0 3 30 9 1 45 43 0.0 3 33 9 1 46 23 0.0 3 19 3 0 1 47 41 0.0 3 33 6 2 48 111 0.0 3 85 21 4 1 49 51 0.0 3 32 13 5 1 50 33 0.0 3 26 3 4 51 45 0.0 3 30 14 1 52 47 0.0 3 35 11 0 1 53 35 0.0 3 22 12 1 54 32 0.0 3 23 6 2 1 55 30 0.0 3 17 11 2 56 33 0.0 3 21 10 2 57 55 0.0 3 41 10 4 58 2252 0.0 3 1722 446 70 14 59 378 0.0 3 280 80 17 1 60 133 0.0 3 77 43 12 1 61 916 0.0 3 696 181 33 6 62 53354 0.0 3 41470 9911 1656 317 63 8064 0.0 3 5786 1840 358 80 64 1542 0.0 3 986 383 130 43 65 328 0.0 3 210 87 27 4 66 88 0.0 3 61 19 7 1 67 38 0.0 3 18 13 5 2 68 55 0.0 3 45 10 69 50 0.0 3 36 9 3 2 70 62 0.0 3 49 12 1 71 70 0.0 3 56 12 1 1 72 66 0.0 3 55 11 73 62 0.0 3 49 12 0 1 74 36 0.0 3 24 10 1 1 75 32 0.0 3 22 9 1 76 26 0.0 3 22 4 77 6 0.0 3 4 0 2 78 4 0.0 3 3 1 79 1 0.0 3 1 80 8 0.0 3 5 3 81 1 0.0 3 1 82 1 0.0 3 0 1 83 13 0.0 3 7 4 2 84 4 0.0 3 1 3 85 1 0.0 3 1 86 9 0.0 3 8 1 87 3 0.0 3 2 1 88 1 0.0 3 1 89 5 0.0 3 2 3 90 5 0.0 3 5 91 2 0.0 3 1 0 1 92 2 0.0 3 2 96 2 0.0 3 2 98 3 0.0 3 2 1 99 1 0.0 3 1 101 2 0.0 3 2 102 3 0.0 3 2 1 120 1 0.0 3 1 127 1 0.0 3 1 === Second read: Adapter 2 === Sequence: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT; Type: regular 3'; Length: 58; Trimmed: 2309 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-58 bp: 5 Bases preceding removed adapters: A: 1.6% C: 72.0% G: 2.0% T: 24.4% none/other: 0.0% Overview of removed sequences length count expect max.err error counts 3 394 1281.8 0 394 4 155 320.5 0 155 5 142 80.1 0 142 6 36 20.0 0 36 7 36 5.0 0 36 8 39 1.3 0 39 9 30 0.3 0 29 1 10 75 0.1 1 54 21 11 41 0.0 1 36 5 12 60 0.0 1 46 14 13 41 0.0 1 38 3 14 47 0.0 1 40 7 15 49 0.0 1 46 3 16 80 0.0 1 75 5 17 67 0.0 1 62 5 18 61 0.0 1 54 7 19 83 0.0 1 68 13 2 20 36 0.0 2 26 7 3 21 61 0.0 2 49 10 2 22 45 0.0 2 25 19 1 23 50 0.0 2 44 3 3 24 58 0.0 2 45 12 1 25 44 0.0 2 36 8 26 96 0.0 2 75 19 2 27 44 0.0 2 34 6 4 28 54 0.0 2 16 9 4 25 29 39 0.0 2 26 10 2 1 30 39 0.0 3 18 20 0 1 31 41 0.0 3 34 4 3 32 38 0.0 3 27 7 3 1 33 28 0.0 3 24 3 0 1 34 32 0.0 3 0 22 9 1 35 36 0.0 3 0 29 7 36 34 0.0 3 0 25 5 4 37 34 0.0 3 0 0 26 8 38 31 0.0 3 0 0 29 2 39 28 0.0 3 0 0 0 28 40 4 0.0 4 0 0 0 0 4 42 1 0.0 4 0 0 0 0 1 WARNING: One or more of your adapter sequences may be incomplete. Please see the detailed output above. This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -g v2_pr_plasmid1=GGATCTAGGTGAAGATCCTTTTTGATAATCTCATG -y {name} -g v2_pr_plasmid2=CTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGT -y {name} -G v2_pr_plasmid1=GGATCTAGGTGAAGATCCTTTTTGATAATCTCATG -y {name} -G v2_pr_plasmid2=CTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGT -y {name} -o /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cut_barc_praimers_cutIL_106_S106_L001_R1_001.fastq.gz -p /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cut_barc_praimers_cutIL_106_S106_L001_R2_001.fastq.gz --overlap 20 /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_106_S106_L001_R1_001.fastq.gz /mnt/storage/home/psbelokopytova/scratch/202111020942Polina/4c_plasmid/2021-10-20//cutadapt/cutIL_106_S106_L001_R2_001.fastq.gz Processing reads on 1 core in paired-end mode ... Finished in 6.77 s (83 us/read; 0.73 M reads/minute). === Summary === Total read pairs processed: 82,037 Read 1 with adapter: 81,448 (99.3%) Read 2 with adapter: 79,494 (96.9%) Pairs written (passing filters): 82,037 (100.0%) Total basepairs processed: 20,461,224 bp Read 1: 8,110,983 bp Read 2: 12,350,241 bp Total written (filtered): 14,445,595 bp (70.6%) Read 1: 5,267,063 bp Read 2: 9,178,532 bp === First read: Adapter v2_pr_plasmid1 === Sequence: GGATCTAGGTGAAGATCCTTTTTGATAATCTCATG; Type: regular 5'; Length: 35; Trimmed: 81448 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-35 bp: 3 Overview of removed sequences length count expect max.err error counts 26 1 0.0 2 0 1 28 1 0.0 2 0 1 29 7 0.0 2 7 30 2 0.0 3 1 0 1 31 26 0.0 3 9 1 6 10 32 209 0.0 3 12 12 33 152 33 781 0.0 3 33 148 516 84 34 4881 0.0 3 597 3714 488 82 35 75097 0.0 3 64741 8841 1252 263 36 408 0.0 3 57 283 48 20 37 31 0.0 3 0 0 22 9 38 4 0.0 3 0 0 0 4 === First read: Adapter v2_pr_plasmid2 === Sequence: CTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGT; Type: regular 5'; Length: 40; Trimmed: 0 times. === Second read: Adapter v2_pr_plasmid1 === Sequence: GGATCTAGGTGAAGATCCTTTTTGATAATCTCATG; Type: regular 5'; Length: 35; Trimmed: 0 times. === Second read: Adapter v2_pr_plasmid2 === Sequence: CTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGT; Type: regular 5'; Length: 40; Trimmed: 79494 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40 bp: 4 Overview of removed sequences length count expect max.err error counts 35 8 0.0 3 0 0 3 5 36 34 0.0 3 1 3 20 4 6 37 258 0.0 3 14 129 31 77 7 38 1335 0.0 3 555 197 502 73 8 39 5900 0.0 3 257 4854 642 103 44 40 70645 0.0 4 60391 8522 1182 365 185 41 1247 0.0 4 44 936 183 47 37 42 46 0.0 4 0 0 32 9 5 43 17 0.0 4 0 0 0 13 4 44 3 0.0 4 0 0 0 0 3 107 1 0.0 4 0 0 0 0 1