This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -o /mnt/storage/home/psbelokopytova/loxP_project/2021-11-22_rings//cutadapt/cutIL_rings1_R1.fq.gz -p /mnt/storage/home/psbelokopytova/loxP_project/2021-11-22_rings//cutadapt/cutIL_rings1_R2.fq.gz /mnt/scratch/ws/psbelokopytova/202112281307data_Polya/4c_plasmid/2021-11-22/P4C25//211102_M067_V350034057_L04_P4C25_1.fq.gz /mnt/scratch/ws/psbelokopytova/202112281307data_Polya/4c_plasmid/2021-11-22/P4C25//211102_M067_V350034057_L04_P4C25_2.fq.gz -m 8 Processing reads on 1 core in paired-end mode ... Finished in 147.34 s (69 us/read; 0.87 M reads/minute). === Summary === Total read pairs processed: 2,129,230 Read 1 with adapter: 484,728 (22.8%) Read 2 with adapter: 451,511 (21.2%) Pairs that were too short: 22 (0.0%) Pairs written (passing filters): 2,129,208 (100.0%) Total basepairs processed: 638,769,000 bp Read 1: 319,384,500 bp Read 2: 319,384,500 bp Total written (filtered): 610,155,327 bp (95.5%) Read 1: 304,049,194 bp Read 2: 306,106,133 bp === First read: Adapter 1 === Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 3'; Length: 34; Trimmed: 484728 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-34 bp: 3 Bases preceding removed adapters: A: 5.5% C: 21.9% G: 1.7% T: 70.9% none/other: 0.0% Overview of removed sequences length count expect max.err error counts 3 10008 33269.2 0 10008 4 2288 8317.3 0 2288 5 24971 2079.3 0 24971 6 5107 519.8 0 5107 7 1281 130.0 0 1281 8 1348 32.5 0 1348 9 67360 8.1 0 48156 19204 10 11706 2.0 1 9426 2280 11 2347 0.5 1 1557 790 12 22525 0.1 1 17162 5363 13 5069 0.0 1 3783 1286 14 3294 0.0 1 2115 1179 15 1219 0.0 1 790 429 16 568 0.0 1 397 171 17 606 0.0 1 409 197 18 472 0.0 1 297 174 1 19 376 0.0 1 241 128 7 20 527 0.0 2 328 158 41 21 1051 0.0 2 712 266 73 22 20713 0.0 2 15083 4550 1080 23 4499 0.0 2 3111 1075 313 24 1425 0.0 2 983 327 115 25 18233 0.0 2 12759 4264 1210 26 4100 0.0 2 2948 907 245 27 902 0.0 2 650 192 60 28 454 0.0 2 302 112 40 29 6749 0.0 2 4616 1639 453 41 30 1741 0.0 3 1139 412 143 47 31 486 0.0 3 332 112 32 10 32 165 0.0 3 107 44 11 3 33 81 0.0 3 55 12 6 8 34 88 0.0 3 63 16 6 3 35 417 0.0 3 294 86 29 8 36 2654 0.0 3 1839 618 165 32 37 599 0.0 3 417 135 36 11 38 144 0.0 3 99 30 10 5 39 82 0.0 3 47 24 9 2 40 300 0.0 3 93 153 46 8 41 4858 0.0 3 3185 1200 341 132 42 172446 0.0 3 116553 40778 11421 3694 43 37199 0.0 3 24800 9069 2467 863 44 6891 0.0 3 4599 1676 460 156 45 1206 0.0 3 804 285 90 27 46 274 0.0 3 176 71 17 10 47 99 0.0 3 69 21 4 5 48 189 0.0 3 127 41 14 7 49 91 0.0 3 54 21 13 3 50 72 0.0 3 39 24 3 6 51 69 0.0 3 43 15 8 3 52 57 0.0 3 38 12 5 2 53 71 0.0 3 38 24 7 2 54 57 0.0 3 35 15 5 2 55 72 0.0 3 35 25 11 1 56 114 0.0 3 68 25 15 6 57 205 0.0 3 136 42 19 8 58 170 0.0 3 83 52 26 9 59 213 0.0 3 123 56 25 9 60 211 0.0 3 95 72 31 13 61 276 0.0 3 143 77 43 13 62 295 0.0 3 163 78 38 16 63 256 0.0 3 135 66 36 19 64 295 0.0 3 163 82 39 11 65 340 0.0 3 198 91 36 15 66 1945 0.0 3 1374 427 102 42 67 678 0.0 3 448 158 47 25 68 423 0.0 3 252 114 38 19 69 457 0.0 3 252 136 51 18 70 3699 0.0 3 2713 747 178 61 71 934 0.0 3 636 225 58 15 72 499 0.0 3 311 129 40 19 73 328 0.0 3 206 80 35 7 74 345 0.0 3 211 84 32 18 75 313 0.0 3 195 74 29 15 76 327 0.0 3 204 83 28 12 77 337 0.0 3 217 77 34 9 78 306 0.0 3 194 68 37 7 79 314 0.0 3 200 74 28 12 80 341 0.0 3 229 75 26 11 81 561 0.0 3 401 112 35 13 82 8683 0.0 3 6893 1522 216 52 83 2024 0.0 3 1553 384 67 20 84 591 0.0 3 442 111 31 7 85 382 0.0 3 262 73 34 13 86 267 0.0 3 197 53 13 4 87 547 0.0 3 411 110 21 5 88 312 0.0 3 223 65 16 8 89 289 0.0 3 203 67 14 5 90 221 0.0 3 155 46 15 5 91 220 0.0 3 149 53 16 2 92 420 0.0 3 323 84 8 5 93 1215 0.0 3 1004 181 22 8 94 1906 0.0 3 1555 297 50 4 95 957 0.0 3 753 175 22 7 96 479 0.0 3 370 85 20 4 97 297 0.0 3 240 45 8 4 98 249 0.0 3 192 36 16 5 99 172 0.0 3 127 31 11 3 100 165 0.0 3 118 40 4 3 101 154 0.0 3 112 32 5 5 102 136 0.0 3 102 22 9 3 103 132 0.0 3 102 24 6 104 147 0.0 3 117 22 7 1 105 120 0.0 3 94 19 5 2 106 124 0.0 3 98 21 3 2 107 104 0.0 3 79 19 2 4 108 80 0.0 3 66 14 109 85 0.0 3 67 12 3 3 110 75 0.0 3 64 11 111 65 0.0 3 58 7 112 45 0.0 3 36 7 1 1 113 36 0.0 3 28 6 2 114 33 0.0 3 27 4 1 1 115 37 0.0 3 29 7 0 1 116 24 0.0 3 19 3 1 1 117 23 0.0 3 20 3 118 16 0.0 3 12 4 119 11 0.0 3 11 120 14 0.0 3 13 1 121 11 0.0 3 8 2 1 122 8 0.0 3 5 3 123 8 0.0 3 5 3 124 7 0.0 3 5 2 125 5 0.0 3 5 126 3 0.0 3 3 127 2 0.0 3 2 128 4 0.0 3 4 131 5 0.0 3 5 132 1 0.0 3 1 133 2 0.0 3 2 135 1 0.0 3 1 137 2 0.0 3 1 1 138 1 0.0 3 1 140 1 0.0 3 1 141 1 0.0 3 1 143 1 0.0 3 1 150 20 0.0 3 0 17 3 === Second read: Adapter 2 === Sequence: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT; Type: regular 3'; Length: 58; Trimmed: 451511 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-58 bp: 5 Bases preceding removed adapters: A: 3.5% C: 1.1% G: 1.8% T: 93.6% none/other: 0.0% WARNING: The adapter is preceded by "T" extremely often. The provided adapter sequence could be incomplete at its 3' end. Overview of removed sequences length count expect max.err error counts 3 8557 33269.2 0 8557 4 3423 8317.3 0 3423 5 25188 2079.3 0 25188 6 5210 519.8 0 5210 7 1341 130.0 0 1341 8 1497 32.5 0 1497 9 59437 8.1 0 53396 6041 10 11825 2.0 1 10258 1567 11 2482 0.5 1 2161 321 12 23642 0.1 1 21483 2159 13 5379 0.0 1 4850 529 14 3579 0.0 1 3036 543 15 1305 0.0 1 1077 228 16 603 0.0 1 491 112 17 631 0.0 1 509 122 18 492 0.0 1 387 102 3 19 385 0.0 1 308 75 2 20 543 0.0 2 410 106 27 21 1050 0.0 2 843 178 29 22 20968 0.0 2 17993 2696 279 23 4610 0.0 2 3850 674 86 24 1451 0.0 2 1197 226 28 25 18606 0.0 2 15205 2989 412 26 4162 0.0 2 3371 687 104 27 902 0.0 2 731 145 25 1 28 448 0.0 2 349 82 15 2 29 6893 0.0 2 5579 1155 141 18 30 1745 0.0 3 1371 296 62 16 31 491 0.0 3 385 76 18 12 32 167 0.0 3 123 30 5 9 33 82 0.0 3 62 12 5 3 34 87 0.0 3 59 18 6 4 35 415 0.0 3 318 52 11 34 36 2637 0.0 3 83 119 2007 427 1 37 595 0.0 3 35 10 432 115 3 38 138 0.0 3 23 8 81 11 15 39 81 0.0 3 35 13 1 16 16 40 327 0.0 4 34 4 2 16 271 41 4752 0.0 4 43 15 15 3805 874 42 168173 0.0 4 1257 207 267 136050 30392 43 35973 0.0 4 281 53 44 28824 6771 44 6234 0.0 4 79 20 7 5179 949 45 996 0.0 4 27 10 6 9 944 46 50 0.0 4 24 12 4 4 6 47 47 0.0 4 29 10 2 3 1 2 48 38 0.0 4 28 6 2 1 0 1 49 52 0.0 4 37 6 5 0 3 1 50 55 0.0 5 31 11 4 5 2 2 51 59 0.0 5 43 10 0 3 3 52 51 0.0 5 36 8 4 2 1 53 56 0.0 5 28 16 6 1 4 1 54 48 0.0 5 26 10 4 5 1 2 55 69 0.0 5 36 18 9 4 0 2 56 107 0.0 5 55 24 15 3 5 5 57 136 0.0 5 64 30 14 12 9 7 58 151 0.0 5 61 46 19 15 7 3 59 205 0.0 5 94 63 22 15 6 5 60 203 0.0 5 87 48 32 15 15 6 61 278 0.0 5 123 76 43 18 12 6 62 300 0.0 5 135 84 28 28 16 9 63 260 0.0 5 127 60 40 22 5 6 64 292 0.0 5 149 70 35 14 17 7 65 302 0.0 5 160 63 36 22 12 9 66 291 0.0 5 156 67 38 17 7 6 67 305 0.0 5 168 67 29 20 16 5 68 335 0.0 5 153 91 48 27 12 4 69 359 0.0 5 176 93 46 22 19 3 70 374 0.0 5 205 90 37 24 10 8 71 299 0.0 5 170 67 37 11 5 9 72 376 0.0 5 182 96 42 34 14 8 73 305 0.0 5 168 68 34 21 9 5 74 333 0.0 5 170 83 42 21 9 8 75 311 0.0 5 171 75 40 10 9 6 76 325 0.0 5 169 78 43 20 11 4 77 338 0.0 5 179 85 42 19 7 6 78 304 0.0 5 149 75 44 24 8 4 79 303 0.0 5 170 83 29 13 4 4 80 328 0.0 5 171 91 41 12 10 3 81 307 0.0 5 176 71 31 18 7 4 82 367 0.0 5 243 58 35 16 9 6 83 273 0.0 5 156 63 31 11 5 7 84 276 0.0 5 160 67 25 12 9 3 85 332 0.0 5 197 81 27 21 3 3 86 253 0.0 5 142 68 22 12 9 87 263 0.0 5 155 66 22 14 3 3 88 249 0.0 5 139 56 31 9 7 7 89 253 0.0 5 155 56 23 10 7 2 90 198 0.0 5 122 36 25 12 1 2 91 207 0.0 5 122 47 23 10 3 2 92 266 0.0 5 167 48 19 20 9 3 93 243 0.0 5 134 59 29 15 5 1 94 260 0.0 5 149 72 24 8 6 1 95 243 0.0 5 154 52 16 9 9 3 96 208 0.0 5 121 49 28 6 2 2 97 181 0.0 5 112 43 16 3 6 1 98 184 0.0 5 105 46 21 9 2 1 99 153 0.0 5 93 40 13 4 3 100 155 0.0 5 91 40 17 5 2 101 156 0.0 5 96 38 13 6 1 2 102 126 0.0 5 79 33 9 5 103 125 0.0 5 76 21 21 4 2 1 104 147 0.0 5 90 35 15 6 1 105 120 0.0 5 80 25 9 3 3 106 121 0.0 5 83 27 8 1 2 107 99 0.0 5 72 14 8 1 3 1 108 78 0.0 5 51 22 4 1 109 81 0.0 5 53 16 6 5 1 110 73 0.0 5 46 19 8 111 66 0.0 5 44 16 4 1 1 112 44 0.0 5 30 12 1 1 113 37 0.0 5 27 7 2 1 114 32 0.0 5 25 5 1 0 0 1 115 40 0.0 5 28 9 1 2 116 24 0.0 5 16 5 3 117 22 0.0 5 16 5 1 118 16 0.0 5 13 3 119 11 0.0 5 8 2 1 120 16 0.0 5 10 5 0 1 121 12 0.0 5 4 5 3 122 8 0.0 5 5 2 1 123 7 0.0 5 5 1 0 1 124 3 0.0 5 2 0 1 125 5 0.0 5 4 1 126 3 0.0 5 1 1 1 127 2 0.0 5 2 128 3 0.0 5 2 1 131 5 0.0 5 5 132 1 0.0 5 1 133 2 0.0 5 1 1 135 1 0.0 5 1 137 2 0.0 5 2 138 1 0.0 5 1 140 1 0.0 5 0 0 0 1 141 1 0.0 5 0 0 1 143 1 0.0 5 1 150 1 0.0 5 0 0 0 1 WARNING: One or more of your adapter sequences may be incomplete. Please see the detailed output above. This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -g ada1=AAACGAGTTTTAATGACTCCAACTTAAGTGTATGTAAACTTCCGACTTCAACTGTA -y {name} -g ada2=ATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCTAAGGTGTATGTAAACTTCCGACTTCAACTGTA -y {name} -G ada1=AAACGAGTTTTAATGACTCCAACTTAAGTGTATGTAAACTTCCGACTTCAACTGTA -y {name} -G ada2=ATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCTAAGGTGTATGTAAACTTCCGACTTCAACTGTA -y {name} -o /mnt/storage/home/psbelokopytova/loxP_project/2021-11-22_rings//cutadapt/cut_barc_praimers_cutIL_rings1_R1.fq.gz -p /mnt/storage/home/psbelokopytova/loxP_project/2021-11-22_rings//cutadapt/cut_barc_praimers_cutIL_rings1_R2.fq.gz /mnt/storage/home/psbelokopytova/loxP_project/2021-11-22_rings//cutadapt/cutIL_rings1_R1.fq.gz /mnt/storage/home/psbelokopytova/loxP_project/2021-11-22_rings//cutadapt/cutIL_rings1_R2.fq.gz --overlap 20 Processing reads on 1 core in paired-end mode ... Finished in 293.65 s (138 us/read; 0.44 M reads/minute). === Summary === Total read pairs processed: 2,129,208 Read 1 with adapter: 1,050,221 (49.3%) Read 2 with adapter: 972,690 (45.7%) Pairs written (passing filters): 2,129,208 (100.0%) Total basepairs processed: 610,155,327 bp Read 1: 304,049,194 bp Read 2: 306,106,133 bp Total written (filtered): 478,029,962 bp (78.3%) Read 1: 226,347,373 bp Read 2: 251,682,589 bp === First read: Adapter ada1 === Sequence: AAACGAGTTTTAATGACTCCAACTTAAGTGTATGTAAACTTCCGACTTCAACTGTA; Type: regular 5'; Length: 56; Trimmed: 5 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-56 bp: 5 Overview of removed sequences length count expect max.err error counts 21 1 0.0 2 1 38 1 0.0 3 0 0 0 1 73 1 0.0 5 0 0 1 74 2 0.0 5 0 0 0 2 === First read: Adapter ada2 === Sequence: ATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCTAAGGTGTATGTAAACTTCCGACTTCAACTGTA; Type: regular 5'; Length: 74; Trimmed: 1050216 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-59 bp: 5; 60-69 bp: 6; 70-74 bp: 7 Overview of removed sequences length count expect max.err error counts 32 2 0.0 3 2 46 2 0.0 4 2 56 19 0.0 5 10 7 1 0 0 1 57 4 0.0 5 2 1 0 1 58 2 0.0 5 1 0 0 1 67 2 0.0 6 0 0 1 0 1 68 8 0.0 6 0 0 1 0 0 0 1 6 69 49 0.0 6 4 1 0 2 10 20 7 5 70 435 0.0 7 3 11 23 59 205 81 37 16 71 2252 0.0 7 49 35 168 1221 509 172 58 40 72 14280 0.0 7 288 530 8361 3489 1068 302 149 93 73 100864 0.0 7 1695 62170 25107 7646 2516 872 602 256 74 884656 0.0 7 561983 225058 63913 19474 7068 4816 1712 632 75 24594 0.0 7 1135 8563 3729 6845 2906 899 373 144 76 6178 0.0 7 2 20 2694 1678 946 462 241 135 77 1709 0.0 7 1 0 3 418 388 539 203 157 78 2492 0.0 7 0 0 0 0 757 528 756 451 79 4949 0.0 7 0 0 0 0 4 2188 1584 1173 80 7220 0.0 7 0 0 0 0 0 8 4646 2566 81 479 0.0 7 0 0 0 0 0 0 11 468 82 1 0.0 7 0 0 0 0 0 0 0 1 94 1 0.0 7 0 0 0 1 95 1 0.0 7 0 0 0 0 0 0 1 96 1 0.0 7 0 0 0 0 1 100 1 0.0 7 0 0 0 0 0 0 0 1 115 3 0.0 7 0 0 0 0 1 0 2 120 1 0.0 7 0 0 0 0 1 123 1 0.0 7 0 0 0 0 1 124 1 0.0 7 0 0 0 0 0 0 0 1 125 1 0.0 7 0 0 0 0 0 1 126 2 0.0 7 0 0 0 2 127 1 0.0 7 0 0 0 0 0 0 1 130 1 0.0 7 0 0 0 0 0 0 1 137 1 0.0 7 0 0 1 141 1 0.0 7 0 0 0 0 1 142 1 0.0 7 0 0 0 0 0 1 150 1 0.0 7 0 0 0 0 0 1 === Second read: Adapter ada1 === Sequence: AAACGAGTTTTAATGACTCCAACTTAAGTGTATGTAAACTTCCGACTTCAACTGTA; Type: regular 5'; Length: 56; Trimmed: 972687 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-56 bp: 5 Overview of removed sequences length count expect max.err error counts 21 5 0.0 2 5 45 1 0.0 4 0 0 1 49 1 0.0 4 0 0 0 0 0 1 50 2 0.0 5 0 0 0 0 0 2 51 33 0.0 5 1 1 0 2 2 27 52 754 0.0 5 2 6 13 47 106 580 53 8698 0.0 5 7 67 287 1053 292 6992 54 11603 0.0 5 263 1711 7311 1721 290 307 55 92842 0.0 5 7662 66095 15766 2383 511 425 56 807920 0.0 5 624899 149247 22249 4241 2425 4859 57 26925 0.0 5 1736 6499 1645 12260 1779 3006 58 6048 0.0 5 9 33 2949 1088 572 1397 59 14426 0.0 5 0 0 8 494 11732 2192 60 1022 0.0 5 0 0 0 1 690 331 61 2395 0.0 5 0 0 0 0 1 2394 62 12 0.0 5 0 0 0 0 0 12 === Second read: Adapter ada2 === Sequence: ATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCTAAGGTGTATGTAAACTTCCGACTTCAACTGTA; Type: regular 5'; Length: 74; Trimmed: 3 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-59 bp: 5; 60-69 bp: 6; 70-74 bp: 7 Overview of removed sequences length count expect max.err error counts 54 1 0.0 5 0 0 0 0 1 56 2 0.0 5 0 0 2