This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -o /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//cutadapt/cutIL_VIR2_1_R1.fq.gz -p /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//cutadapt/cutIL_VIR2_1_R2.fq.gz /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//raw/VIR2_1_R1.fastq.gz /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//raw/VIR2_1_R2.fastq.gz -m 8 Processing reads on 1 core in paired-end mode ... Finished in 111.17 s (36 us/read; 1.65 M reads/minute). === Summary === Total read pairs processed: 3,049,220 Read 1 with adapter: 794,681 (26.1%) Read 2 with adapter: 2,157 (0.1%) Pairs that were too short: 0 (0.0%) Pairs written (passing filters): 3,049,220 (100.0%) Total basepairs processed: 975,750,400 bp Read 1: 457,383,000 bp Read 2: 518,367,400 bp Total written (filtered): 966,970,501 bp (99.1%) Read 1: 448,614,234 bp Read 2: 518,356,267 bp === First read: Adapter 1 === Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 3'; Length: 34; Trimmed: 794681 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-34 bp: 3 Bases preceding removed adapters: A: 14.5% C: 0.3% G: 0.3% T: 84.9% none/other: 0.0% WARNING: The adapter is preceded by "T" extremely often. The provided adapter sequence could be incomplete at its 3' end. Overview of removed sequences length count expect max.err error counts 3 274928 47644.1 0 274928 4 38456 11911.0 0 38456 5 256520 2977.8 0 256520 6 54483 744.4 0 54483 7 10785 186.1 0 10785 8 18300 46.5 0 18300 9 4642 11.6 0 3815 827 10 809 2.9 1 635 174 11 290 0.7 1 248 42 12 57 0.2 1 46 11 13 13 0.0 1 11 2 14 12 0.0 1 11 1 15 135 0.0 1 118 17 16 31 0.0 1 25 6 17 14 0.0 1 6 8 18 361 0.0 1 249 109 3 19 11810 0.0 1 7288 4212 310 20 2330 0.0 2 1253 768 309 21 381 0.0 2 199 127 55 22 147 0.0 2 112 26 9 23 119 0.0 2 74 32 13 24 646 0.0 2 480 136 30 25 21140 0.0 2 15675 4393 1072 26 4200 0.0 2 3041 948 211 27 1418 0.0 2 996 337 82 3 28 23833 0.0 2 17379 4961 1388 105 29 5020 0.0 2 3586 1072 328 34 30 928 0.0 3 639 221 62 6 31 145 0.0 3 98 28 14 5 32 37 0.0 3 24 11 1 1 33 1 0.0 3 0 0 1 34 16 0.0 3 11 3 1 1 35 64 0.0 3 47 13 4 36 44 0.0 3 23 17 4 37 21 0.0 3 10 5 3 3 38 9 0.0 3 6 1 2 39 9 0.0 3 3 2 4 40 138 0.0 3 100 25 9 4 41 4515 0.0 3 3028 1055 358 74 42 907 0.0 3 591 216 84 16 43 323 0.0 3 205 81 27 10 44 71 0.0 3 42 15 11 3 45 9 0.0 3 6 2 1 46 6 0.0 3 5 1 47 2 0.0 3 1 1 48 1 0.0 3 1 49 5 0.0 3 1 2 2 50 256 0.0 3 152 74 28 2 51 74 0.0 3 41 22 9 2 52 168 0.0 3 101 45 17 5 53 58 0.0 3 38 15 5 54 13 0.0 3 7 4 2 55 2 0.0 3 1 1 57 39 0.0 3 11 13 14 1 58 487 0.0 3 244 150 80 13 59 23382 0.0 3 12633 6637 3423 689 60 5536 0.0 3 3052 1516 821 147 61 1032 0.0 3 561 299 150 22 62 226 0.0 3 123 61 36 6 63 29 0.0 3 14 9 6 64 8 0.0 3 5 1 1 1 65 1 0.0 3 1 66 2 0.0 3 2 67 3 0.0 3 2 0 1 68 1 0.0 3 0 0 1 69 9 0.0 3 1 7 0 1 70 139 0.0 3 56 46 34 3 71 4696 0.0 3 2358 1364 821 153 72 1066 0.0 3 481 336 210 39 73 7768 0.0 3 3803 2272 1420 273 74 1900 0.0 3 925 561 356 58 75 286 0.0 3 114 82 77 13 76 85 0.0 3 33 34 15 3 77 36 0.0 3 22 7 7 78 7 0.0 3 5 1 1 79 16 0.0 3 9 3 3 1 80 11 0.0 3 8 2 1 81 4 0.0 3 1 2 1 82 6 0.0 3 5 1 84 1 0.0 3 0 0 1 85 17 0.0 3 1 8 7 1 86 222 0.0 3 84 65 61 12 87 6334 0.0 3 2075 2090 1861 308 88 1443 0.0 3 475 437 462 69 89 301 0.0 3 82 115 89 15 90 67 0.0 3 22 16 27 2 91 636 0.0 3 291 181 140 24 92 131 0.0 3 52 42 31 6 93 23 0.0 3 10 5 8 94 3 0.0 3 1 1 0 1 95 1 0.0 3 1 96 1 0.0 3 1 97 15 0.0 3 8 7 98 6 0.0 3 4 2 99 2 0.0 3 1 1 107 1 0.0 3 0 1 === Second read: Adapter 2 === Sequence: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT; Type: regular 3'; Length: 58; Trimmed: 2157 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-58 bp: 5 Bases preceding removed adapters: A: 92.2% C: 4.9% G: 0.6% T: 2.3% none/other: 0.0% WARNING: The adapter is preceded by "A" extremely often. The provided adapter sequence could be incomplete at its 3' end. Overview of removed sequences length count expect max.err error counts 3 2001 47644.1 0 2001 4 103 11911.0 0 103 71 1 0.0 5 0 0 0 1 72 1 0.0 5 0 0 0 1 73 1 0.0 5 0 0 0 1 75 1 0.0 5 0 0 1 79 14 0.0 5 7 0 0 6 1 80 1 0.0 5 1 81 3 0.0 5 1 2 83 1 0.0 5 1 85 1 0.0 5 1 87 1 0.0 5 1 88 1 0.0 5 0 0 0 1 89 1 0.0 5 0 0 1 90 1 0.0 5 1 91 4 0.0 5 0 0 0 3 0 1 93 6 0.0 5 2 0 0 3 1 94 2 0.0 5 1 0 0 1 97 2 0.0 5 1 0 1 99 2 0.0 5 1 0 1 107 7 0.0 5 2 0 1 2 2 108 1 0.0 5 0 1 117 1 0.0 5 1 WARNING: One or more of your adapter sequences may be incomplete. Please see the detailed output above. This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -g ada1=AAACGAGTTTTAATGACTCCAACTTAAGTGTATGTAAACTTCCGACTTCAACTGTA -y {name} -g ada2=ATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCTAAGGTGTATGTAAACTTCCGACTTCAACTGTA -y {name} -G ada1=AAACGAGTTTTAATGACTCCAACTTAAGTGTATGTAAACTTCCGACTTCAACTGTA -y {name} -G ada2=ATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCTAAGGTGTATGTAAACTTCCGACTTCAACTGTA -y {name} -o /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//cutadapt/cut_barc_praimers_cutIL_VIR2_1_R1.fq.gz -p /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//cutadapt/cut_barc_praimers_cutIL_VIR2_1_R2.fq.gz /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//cutadapt/cutIL_VIR2_1_R1.fq.gz /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//cutadapt/cutIL_VIR2_1_R2.fq.gz --overlap 20 Processing reads on 1 core in paired-end mode ... Finished in 267.39 s (88 us/read; 0.68 M reads/minute). === Summary === Total read pairs processed: 3,049,220 Read 1 with adapter: 2,168,444 (71.1%) Read 2 with adapter: 2,814,292 (92.3%) Pairs written (passing filters): 3,049,220 (100.0%) Total basepairs processed: 966,970,501 bp Read 1: 448,614,234 bp Read 2: 518,356,267 bp Total written (filtered): 650,641,849 bp (67.3%) Read 1: 289,696,687 bp Read 2: 360,945,162 bp === First read: Adapter ada1 === Sequence: AAACGAGTTTTAATGACTCCAACTTAAGTGTATGTAAACTTCCGACTTCAACTGTA; Type: regular 5'; Length: 56; Trimmed: 1 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-56 bp: 5 Overview of removed sequences length count expect max.err error counts 56 1 0.0 5 1 === First read: Adapter ada2 === Sequence: ATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCTAAGGTGTATGTAAACTTCCGACTTCAACTGTA; Type: regular 5'; Length: 74; Trimmed: 2168443 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-59 bp: 5; 60-69 bp: 6; 70-74 bp: 7 Overview of removed sequences length count expect max.err error counts 32 1 0.0 3 1 46 4 0.0 4 2 1 1 52 1 0.0 5 0 0 0 0 0 1 54 1 0.0 5 0 0 0 0 0 1 56 19 0.0 5 12 2 2 3 57 3 0.0 5 1 0 1 0 1 58 2 0.0 5 0 1 1 61 1 0.0 6 0 0 0 0 0 1 63 1 0.0 6 0 0 0 1 65 1 0.0 6 0 0 0 0 0 0 0 1 66 9 0.0 6 0 0 0 0 0 3 3 3 67 71 0.0 6 0 0 0 0 1 15 14 41 68 3981 0.0 6 0 0 1 2 2 127 199 3650 69 30742 0.0 6 3 5 4 1 20 757 26912 3040 70 292612 0.0 7 10 20 35 99 688 256867 30307 4586 71 11359 0.0 7 68 69 285 2304 814 2313 4886 620 72 44837 0.0 7 475 889 14140 3568 12239 11603 1591 332 73 374085 0.0 7 2869 108526 21645 115351 107954 13625 2602 1513 74 1311591 0.0 7 1002279 237382 42698 15674 7447 3372 1635 1104 75 26023 0.0 7 1957 13572 3383 1070 4726 971 191 153 76 9005 0.0 7 2 37 3480 1730 2268 808 532 148 77 20458 0.0 7 0 0 10 9773 5895 3667 812 301 78 30341 0.0 7 0 0 0 18 23533 4236 1169 1385 79 6919 0.0 7 1 0 0 0 57 3986 1773 1102 80 6186 0.0 7 0 0 0 0 1 3 3994 2188 81 190 0.0 7 0 0 0 0 0 0 9 181 === Second read: Adapter ada1 === Sequence: AAACGAGTTTTAATGACTCCAACTTAAGTGTATGTAAACTTCCGACTTCAACTGTA; Type: regular 5'; Length: 56; Trimmed: 2814291 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-56 bp: 5 Overview of removed sequences length count expect max.err error counts 21 9 0.0 2 8 1 23 1 0.0 2 0 0 1 49 1 0.0 4 0 0 0 0 0 1 50 25 0.0 5 0 0 1 1 1 22 51 693 0.0 5 7 1 3 6 2 674 52 1183 0.0 5 8 32 43 168 282 650 53 4749 0.0 5 31 229 1170 2739 343 237 54 34973 0.0 5 920 5970 24255 2483 249 1096 55 269198 0.0 5 26595 215352 23896 2366 696 293 56 2431458 0.0 5 2141437 253906 24792 6772 1840 2711 57 31924 0.0 5 5795 20979 2440 611 180 1919 58 9411 0.0 5 37 101 2613 1038 483 5139 59 4310 0.0 5 1 1 8 2894 747 659 60 22621 0.0 5 0 0 0 9 544 22068 61 3724 0.0 5 0 0 0 0 2 3722 62 11 0.0 5 0 0 0 0 0 11 === Second read: Adapter ada2 === Sequence: ATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCTAAGGTGTATGTAAACTTCCGACTTCAACTGTA; Type: regular 5'; Length: 74; Trimmed: 1 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-59 bp: 5; 60-69 bp: 6; 70-74 bp: 7 Overview of removed sequences length count expect max.err error counts 56 1 0.0 5 0 0 0 1 This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -o /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//cutadapt/cutIL_VIR2_3_R1.fq.gz -p /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//cutadapt/cutIL_VIR2_3_R2.fq.gz /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//raw/VIR2_3_R1.fastq.gz /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//raw/VIR2_3_R2.fastq.gz -m 8 Processing reads on 1 core in paired-end mode ... Finished in 182.09 s (35 us/read; 1.71 M reads/minute). === Summary === Total read pairs processed: 5,203,346 Read 1 with adapter: 696,689 (13.4%) Read 2 with adapter: 4,830 (0.1%) Pairs that were too short: 0 (0.0%) Pairs written (passing filters): 5,203,346 (100.0%) Total basepairs processed: 1,665,070,720 bp Read 1: 780,501,900 bp Read 2: 884,568,820 bp Total written (filtered): 1,652,255,769 bp (99.2%) Read 1: 767,710,030 bp Read 2: 884,545,739 bp === First read: Adapter 1 === Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 3'; Length: 34; Trimmed: 696689 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-34 bp: 3 Bases preceding removed adapters: A: 1.7% C: 8.6% G: 0.4% T: 89.3% none/other: 0.0% WARNING: The adapter is preceded by "T" extremely often. The provided adapter sequence could be incomplete at its 3' end. Overview of removed sequences length count expect max.err error counts 3 150280 81302.3 0 150280 4 15239 20325.6 0 15239 5 5029 5081.4 0 5029 6 998 1270.3 0 998 7 274 317.6 0 274 8 734 79.4 0 734 9 903 19.8 0 333 570 10 4806 5.0 1 4358 448 11 153527 1.2 1 140381 13146 12 28984 0.3 1 26015 2969 13 4879 0.1 1 4262 617 14 946 0.0 1 798 148 15 187 0.0 1 155 32 16 41 0.0 1 36 5 17 20 0.0 1 17 3 18 337 0.0 1 280 52 5 19 172 0.0 1 118 52 2 20 37 0.0 2 30 5 2 21 19 0.0 2 13 5 1 22 18 0.0 2 12 6 23 367 0.0 2 222 120 25 24 2183 0.0 2 1716 399 68 25 74104 0.0 2 58700 13040 2364 26 15772 0.0 2 12201 2993 578 27 5118 0.0 2 3851 1054 206 7 28 75610 0.0 2 56975 15282 3246 107 29 80791 0.0 2 63544 14162 2816 269 30 16689 0.0 3 12904 2992 630 163 31 3044 0.0 3 2317 571 128 28 32 1093 0.0 3 830 210 47 6 33 219 0.0 3 156 46 15 2 34 41 0.0 3 30 9 2 35 467 0.0 3 324 105 32 6 36 686 0.0 3 484 155 35 12 37 18239 0.0 3 13176 3830 977 256 38 4406 0.0 3 3252 852 241 61 39 854 0.0 3 623 172 45 14 40 162 0.0 3 116 29 13 4 41 75 0.0 3 50 21 3 1 42 15 0.0 3 9 1 3 2 43 26 0.0 3 18 6 2 44 38 0.0 3 23 9 6 45 8 0.0 3 6 1 1 46 25 0.0 3 17 7 0 1 47 115 0.0 3 67 29 14 5 48 38 0.0 3 8 21 5 4 49 490 0.0 3 342 111 30 7 50 19232 0.0 3 13394 4349 1203 286 51 4240 0.0 3 2917 977 287 59 52 646 0.0 3 437 147 51 11 53 120 0.0 3 88 21 9 2 54 440 0.0 3 280 106 32 22 55 15 0.0 3 6 3 6 56 12 0.0 3 8 4 57 58 0.0 3 34 18 5 1 58 9 0.0 3 4 2 1 2 59 307 0.0 3 181 78 40 8 60 76 0.0 3 47 19 6 4 61 46 0.0 3 22 16 5 3 62 73 0.0 3 41 20 10 2 63 133 0.0 3 83 34 13 3 64 348 0.0 3 218 98 21 11 65 58 0.0 3 32 16 9 1 66 68 0.0 3 42 20 6 67 11 0.0 3 9 1 0 1 68 4 0.0 3 3 1 69 4 0.0 3 2 2 70 9 0.0 3 6 2 1 71 243 0.0 3 152 64 21 6 72 48 0.0 3 31 14 3 73 135 0.0 3 75 42 10 8 74 70 0.0 3 36 21 10 3 75 33 0.0 3 15 9 6 3 76 25 0.0 3 16 8 0 1 77 43 0.0 3 26 10 3 4 78 7 0.0 3 4 0 2 1 79 82 0.0 3 40 25 13 4 80 948 0.0 3 569 243 107 29 81 223 0.0 3 125 56 33 9 82 73 0.0 3 42 20 5 6 83 17 0.0 3 7 9 0 1 84 6 0.0 3 3 3 86 13 0.0 3 7 3 2 1 87 372 0.0 3 205 119 40 8 88 154 0.0 3 99 42 9 4 89 27 0.0 3 22 3 2 90 11 0.0 3 4 5 2 91 23 0.0 3 15 5 2 1 92 8 0.0 3 5 1 2 94 2 0.0 3 0 1 1 95 2 0.0 3 2 96 1 0.0 3 1 97 77 0.0 3 62 11 3 1 98 25 0.0 3 21 3 0 1 99 5 0.0 3 4 1 103 1 0.0 3 0 0 0 1 124 1 0.0 3 0 0 1 === Second read: Adapter 2 === Sequence: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT; Type: regular 3'; Length: 58; Trimmed: 4830 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-58 bp: 5 Bases preceding removed adapters: A: 0.2% C: 0.5% G: 0.4% T: 99.0% none/other: 0.0% WARNING: The adapter is preceded by "T" extremely often. The provided adapter sequence could be incomplete at its 3' end. Overview of removed sequences length count expect max.err error counts 3 4722 81302.3 0 4722 69 2 0.0 5 0 0 0 0 0 2 70 18 0.0 5 0 0 0 0 15 3 71 11 0.0 5 0 0 0 10 1 72 2 0.0 5 0 0 2 74 11 0.0 5 0 0 0 4 5 2 75 3 0.0 5 0 0 3 76 1 0.0 5 0 0 0 1 77 1 0.0 5 0 0 0 0 1 79 1 0.0 5 0 0 0 1 80 2 0.0 5 1 1 81 2 0.0 5 0 0 1 0 1 82 7 0.0 5 1 2 2 1 1 83 2 0.0 5 0 0 1 1 84 6 0.0 5 2 3 0 0 0 1 85 5 0.0 5 0 4 0 0 1 86 1 0.0 5 0 1 88 2 0.0 5 1 0 0 1 89 1 0.0 5 1 91 6 0.0 5 3 1 1 0 1 93 3 0.0 5 1 1 0 0 1 94 4 0.0 5 3 0 0 0 1 95 1 0.0 5 0 1 97 2 0.0 5 1 1 98 1 0.0 5 1 99 1 0.0 5 1 100 1 0.0 5 1 101 2 0.0 5 1 1 103 1 0.0 5 1 104 1 0.0 5 1 106 1 0.0 5 1 108 2 0.0 5 1 1 114 1 0.0 5 0 0 1 115 2 0.0 5 0 1 0 0 1 117 1 0.0 5 1 WARNING: One or more of your adapter sequences may be incomplete. Please see the detailed output above. This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -g ada1=AAACGAGTTTTAATGACTCCAACTTAAGTGTATGTAAACTTCCGACTTCAACTGTA -y {name} -g ada2=ATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCTAAGGTGTATGTAAACTTCCGACTTCAACTGTA -y {name} -G ada1=AAACGAGTTTTAATGACTCCAACTTAAGTGTATGTAAACTTCCGACTTCAACTGTA -y {name} -G ada2=ATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCTAAGGTGTATGTAAACTTCCGACTTCAACTGTA -y {name} -o /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//cutadapt/cut_barc_praimers_cutIL_VIR2_3_R1.fq.gz -p /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//cutadapt/cut_barc_praimers_cutIL_VIR2_3_R2.fq.gz /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//cutadapt/cutIL_VIR2_3_R1.fq.gz /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//cutadapt/cutIL_VIR2_3_R2.fq.gz --overlap 20 Processing reads on 1 core in paired-end mode ... Finished in 436.60 s (84 us/read; 0.72 M reads/minute). === Summary === Total read pairs processed: 5,203,346 Read 1 with adapter: 2,699,464 (51.9%) Read 2 with adapter: 4,976,784 (95.6%) Pairs written (passing filters): 5,203,346 (100.0%) Total basepairs processed: 1,652,255,769 bp Read 1: 767,710,030 bp Read 2: 884,545,739 bp Total written (filtered): 1,174,378,089 bp (71.1%) Read 1: 568,183,879 bp Read 2: 606,194,210 bp === First read: Adapter ada1 === Sequence: AAACGAGTTTTAATGACTCCAACTTAAGTGTATGTAAACTTCCGACTTCAACTGTA; Type: regular 5'; Length: 56; Trimmed: 3 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-56 bp: 5 Overview of removed sequences length count expect max.err error counts 25 1 0.0 2 0 1 32 1 0.0 3 0 1 56 1 0.0 5 0 1 === First read: Adapter ada2 === Sequence: ATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCTAAGGTGTATGTAAACTTCCGACTTCAACTGTA; Type: regular 5'; Length: 74; Trimmed: 2699461 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-59 bp: 5; 60-69 bp: 6; 70-74 bp: 7 Overview of removed sequences length count expect max.err error counts 46 6 0.0 4 6 53 2 0.0 5 0 0 0 0 0 2 56 36 0.0 5 29 4 2 1 57 8 0.0 5 7 1 58 4 0.0 5 4 67 12 0.0 6 0 0 0 0 0 2 2 8 68 108 0.0 6 3 2 1 2 0 4 39 57 69 758 0.0 6 6 9 11 7 32 108 422 163 70 5013 0.0 7 14 26 99 179 709 3053 544 389 71 11057 0.0 7 141 148 594 3946 950 212 1310 3756 72 54150 0.0 7 841 1601 25820 5375 1064 1870 14166 3413 73 251281 0.0 7 5428 195577 37214 7424 3501 1110 444 583 74 2303702 0.0 7 1831834 368408 61927 25155 8990 3018 2498 1872 75 37979 0.0 7 3743 24991 5610 1566 1049 272 465 283 76 12399 0.0 7 10 64 5073 1627 655 2782 1245 943 77 3859 0.0 7 1 1 16 693 306 595 1597 650 78 2775 0.0 7 1 0 0 2 1215 555 684 318 79 4191 0.0 7 0 0 0 0 1 2279 948 963 80 6962 0.0 7 0 1 0 0 0 3 5193 1765 81 5145 0.0 7 0 0 0 0 0 0 12 5133 82 14 0.0 7 0 0 0 0 0 0 0 14 === Second read: Adapter ada1 === Sequence: AAACGAGTTTTAATGACTCCAACTTAAGTGTATGTAAACTTCCGACTTCAACTGTA; Type: regular 5'; Length: 56; Trimmed: 4976779 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-56 bp: 5 Overview of removed sequences length count expect max.err error counts 21 16 0.0 2 14 2 50 15 0.0 5 0 0 1 0 0 14 51 312 0.0 5 7 5 2 14 26 258 52 12338 0.0 5 20 44 84 296 594 11300 53 8700 0.0 5 52 428 2093 5220 726 181 54 63242 0.0 5 1574 10247 43334 5271 682 2134 55 472332 0.0 5 43404 373024 44800 5540 1962 3602 56 4139342 0.0 5 3605081 445536 52271 16130 16868 3456 57 253535 0.0 5 10240 76115 9377 135637 19531 2635 58 16659 0.0 5 35 285 5800 2399 7107 1033 59 3321 0.0 5 1 4 13 1684 891 728 60 3689 0.0 5 0 0 0 10 2494 1185 61 3269 0.0 5 0 0 0 1 6 3262 62 7 0.0 5 0 0 0 0 0 7 104 1 0.0 5 1 117 1 0.0 5 0 0 0 0 0 1 === Second read: Adapter ada2 === Sequence: ATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCTAAGGTGTATGTAAACTTCCGACTTCAACTGTA; Type: regular 5'; Length: 74; Trimmed: 5 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-59 bp: 5; 60-69 bp: 6; 70-74 bp: 7 Overview of removed sequences length count expect max.err error counts 56 3 0.0 5 0 1 2 73 1 0.0 7 0 0 1 74 1 0.0 7 1 This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -o /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//cutadapt/cutIL_VIR2_4_R1.fq.gz -p /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//cutadapt/cutIL_VIR2_4_R2.fq.gz /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//raw/VIR2_4_R1.fastq.gz /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//raw/VIR2_4_R2.fastq.gz -m 8 Processing reads on 1 core in paired-end mode ... Finished in 150.81 s (36 us/read; 1.68 M reads/minute). === Summary === Total read pairs processed: 4,221,813 Read 1 with adapter: 738,983 (17.5%) Read 2 with adapter: 142 (0.0%) Pairs that were too short: 0 (0.0%) Pairs written (passing filters): 4,221,813 (100.0%) Total basepairs processed: 1,350,980,160 bp Read 1: 633,271,950 bp Read 2: 717,708,210 bp Total written (filtered): 1,336,637,786 bp (98.9%) Read 1: 618,940,978 bp Read 2: 717,696,808 bp === First read: Adapter 1 === Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC; Type: regular 3'; Length: 34; Trimmed: 738983 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-34 bp: 3 Bases preceding removed adapters: A: 1.1% C: 0.7% G: 0.1% T: 98.1% none/other: 0.0% WARNING: The adapter is preceded by "T" extremely often. The provided adapter sequence could be incomplete at its 3' end. Overview of removed sequences length count expect max.err error counts 3 154456 65965.8 0 154456 4 32228 16491.5 0 32228 5 7501 4122.9 0 7501 6 1572 1030.7 0 1572 7 4532 257.7 0 4532 8 136495 64.4 0 136495 9 34106 16.1 0 29831 4275 10 5398 4.0 1 4987 411 11 1786 1.0 1 1573 213 12 6791 0.3 1 4459 2332 13 1278 0.1 1 804 474 14 450 0.0 1 287 163 15 124 0.0 1 96 28 16 137 0.0 1 85 52 17 2376 0.0 1 2082 294 18 54744 0.0 1 47772 6769 203 19 11336 0.0 1 9790 1474 72 20 1979 0.0 2 1666 270 43 21 418 0.0 2 302 103 13 22 1458 0.0 2 1239 193 26 23 51786 0.0 2 42407 7813 1566 24 9887 0.0 2 7735 1719 433 25 2773 0.0 2 2074 551 148 26 1125 0.0 2 817 244 64 27 263 0.0 2 182 62 19 28 648 0.0 2 485 127 35 1 29 5414 0.0 2 4078 1087 224 25 30 1160 0.0 3 855 233 59 13 31 201 0.0 3 144 45 12 32 29 0.0 3 14 10 5 33 208 0.0 3 102 85 19 2 34 2225 0.0 3 1614 455 130 26 35 77919 0.0 3 57129 15994 3985 811 36 29961 0.0 3 21824 6155 1649 333 37 6011 0.0 3 4317 1270 355 69 38 1110 0.0 3 781 233 77 19 39 339 0.0 3 233 67 33 6 40 4921 0.0 3 3486 1071 315 49 41 1132 0.0 3 803 256 61 12 42 203 0.0 3 129 60 12 2 43 198 0.0 3 140 37 19 2 44 7093 0.0 3 5038 1520 430 105 45 1526 0.0 3 1045 361 101 19 46 2334 0.0 3 1604 546 160 24 47 552 0.0 3 399 119 30 4 48 131 0.0 3 70 40 19 2 49 553 0.0 3 399 118 30 6 50 20571 0.0 3 14560 4511 1273 227 51 5455 0.0 3 3720 1252 406 77 52 825 0.0 3 553 200 60 12 53 160 0.0 3 107 36 12 5 54 31 0.0 3 20 8 2 1 55 10 0.0 3 1 8 1 56 141 0.0 3 93 27 20 1 57 8640 0.0 3 5635 2125 757 123 58 1954 0.0 3 1243 505 175 31 59 10024 0.0 3 6886 2285 748 105 60 2434 0.0 3 1683 565 165 21 61 769 0.0 3 503 188 69 9 62 11843 0.0 3 8132 2752 813 146 63 2682 0.0 3 1882 576 194 30 64 540 0.0 3 354 143 39 4 65 68 0.0 3 43 13 10 2 66 93 0.0 3 58 24 8 3 67 21 0.0 3 11 6 4 68 8 0.0 3 6 2 69 1 0.0 3 1 70 5 0.0 3 3 2 71 54 0.0 3 31 17 6 72 19 0.0 3 9 1 7 2 73 119 0.0 3 63 38 15 3 74 54 0.0 3 30 16 6 2 75 11 0.0 3 5 4 2 76 19 0.0 3 16 2 1 77 98 0.0 3 65 24 7 2 78 36 0.0 3 23 6 6 1 79 787 0.0 3 391 227 151 18 80 223 0.0 3 125 53 40 5 81 45 0.0 3 21 15 7 2 82 21 0.0 3 12 7 2 83 7 0.0 3 5 2 86 30 0.0 3 16 9 5 87 629 0.0 3 372 155 94 8 88 1292 0.0 3 627 395 250 20 89 256 0.0 3 125 70 57 4 90 56 0.0 3 19 20 15 2 91 39 0.0 3 22 9 6 2 92 9 0.0 3 6 2 1 93 3 0.0 3 1 2 95 1 0.0 3 1 96 1 0.0 3 0 1 97 18 0.0 3 14 3 1 98 9 0.0 3 8 1 99 1 0.0 3 0 1 100 2 0.0 3 1 1 108 1 0.0 3 1 124 1 0.0 3 0 0 1 === Second read: Adapter 2 === Sequence: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT; Type: regular 3'; Length: 58; Trimmed: 142 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-58 bp: 5 Bases preceding removed adapters: A: 3.5% C: 2.8% G: 4.2% T: 89.4% none/other: 0.0% WARNING: The adapter is preceded by "T" extremely often. The provided adapter sequence could be incomplete at its 3' end. Overview of removed sequences length count expect max.err error counts 3 1 65965.8 0 1 46 1 0.0 4 0 0 0 0 1 55 2 0.0 5 0 0 0 0 0 2 69 1 0.0 5 0 0 0 0 0 1 70 11 0.0 5 0 0 0 0 8 3 71 32 0.0 5 0 0 0 27 1 4 72 3 0.0 5 0 0 3 73 2 0.0 5 0 0 0 2 74 2 0.0 5 0 0 0 1 0 1 77 13 0.0 5 0 0 0 7 6 78 9 0.0 5 6 0 0 2 0 1 79 10 0.0 5 4 0 0 4 1 1 80 3 0.0 5 0 1 0 1 1 81 2 0.0 5 1 1 82 11 0.0 5 4 1 0 6 83 2 0.0 5 2 84 2 0.0 5 1 0 0 0 1 85 2 0.0 5 1 1 86 1 0.0 5 1 87 1 0.0 5 0 0 0 1 88 1 0.0 5 0 1 89 1 0.0 5 0 0 1 90 1 0.0 5 1 92 1 0.0 5 0 1 93 1 0.0 5 0 0 1 94 3 0.0 5 1 0 0 1 1 97 3 0.0 5 3 99 3 0.0 5 1 0 0 1 0 1 100 1 0.0 5 1 101 1 0.0 5 1 102 2 0.0 5 0 1 0 0 1 103 1 0.0 5 0 0 0 0 1 107 6 0.0 5 5 0 0 0 1 108 3 0.0 5 2 0 1 109 1 0.0 5 0 1 115 1 0.0 5 1 128 1 0.0 5 1 WARNING: One or more of your adapter sequences may be incomplete. Please see the detailed output above. This is cutadapt 2.3 with Python 3.7.3 Command line parameters: -g ada1=AAACGAGTTTTAATGACTCCAACTTAAGTGTATGTAAACTTCCGACTTCAACTGTA -y {name} -g ada2=ATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCTAAGGTGTATGTAAACTTCCGACTTCAACTGTA -y {name} -G ada1=AAACGAGTTTTAATGACTCCAACTTAAGTGTATGTAAACTTCCGACTTCAACTGTA -y {name} -G ada2=ATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCTAAGGTGTATGTAAACTTCCGACTTCAACTGTA -y {name} -o /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//cutadapt/cut_barc_praimers_cutIL_VIR2_4_R1.fq.gz -p /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//cutadapt/cut_barc_praimers_cutIL_VIR2_4_R2.fq.gz /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//cutadapt/cutIL_VIR2_4_R1.fq.gz /mnt/storage/home/psbelokopytova/loxP_project/2022-07-25_rings//cutadapt/cutIL_VIR2_4_R2.fq.gz --overlap 20 Processing reads on 1 core in paired-end mode ... Finished in 361.28 s (86 us/read; 0.70 M reads/minute). === Summary === Total read pairs processed: 4,221,813 Read 1 with adapter: 2,106,816 (49.9%) Read 2 with adapter: 3,578,941 (84.8%) Pairs written (passing filters): 4,221,813 (100.0%) Total basepairs processed: 1,336,637,786 bp Read 1: 618,940,978 bp Read 2: 717,696,808 bp Total written (filtered): 980,347,641 bp (73.3%) Read 1: 462,184,624 bp Read 2: 518,163,017 bp === First read: Adapter ada1 === Sequence: AAACGAGTTTTAATGACTCCAACTTAAGTGTATGTAAACTTCCGACTTCAACTGTA; Type: regular 5'; Length: 56; Trimmed: 2 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-56 bp: 5 Overview of removed sequences length count expect max.err error counts 21 2 0.0 2 1 1 === First read: Adapter ada2 === Sequence: ATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCTAAGGTGTATGTAAACTTCCGACTTCAACTGTA; Type: regular 5'; Length: 74; Trimmed: 2106814 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-59 bp: 5; 60-69 bp: 6; 70-74 bp: 7 Overview of removed sequences length count expect max.err error counts 32 3 0.0 3 3 46 1 0.0 4 1 53 1 0.0 5 0 0 0 0 0 1 56 16 0.0 5 12 2 2 57 7 0.0 5 4 2 0 1 58 4 0.0 5 2 2 59 1 0.0 5 0 0 1 60 1 0.0 6 0 0 0 0 0 1 64 1 0.0 6 0 0 0 0 0 0 1 66 2 0.0 6 0 1 0 0 0 0 1 67 13 0.0 6 0 0 0 0 0 0 1 12 68 194 0.0 6 0 0 1 2 0 4 12 175 69 444 0.0 6 1 6 6 3 17 65 195 151 70 2968 0.0 7 6 24 49 116 424 1827 271 251 71 4988 0.0 7 99 73 375 2597 736 168 161 779 72 25879 0.0 7 606 1061 17502 4649 920 427 442 272 73 183604 0.0 7 3486 134313 33836 6849 2957 1133 420 610 74 1610025 0.0 7 1219220 282465 65861 23484 10195 3451 3256 2093 75 36242 0.0 7 2480 17099 5167 8501 1830 783 236 146 76 92315 0.0 7 8 38 68061 13384 7384 1916 574 950 77 4538 0.0 7 0 2 144 1211 345 315 215 2306 78 19293 0.0 7 0 0 0 6 777 480 14108 3922 79 10573 0.0 7 0 0 0 0 3 2808 1752 6010 80 56101 0.0 7 0 0 0 0 0 4 46907 9190 81 59479 0.0 7 0 0 0 0 0 0 93 59386 82 121 0.0 7 0 0 0 0 0 0 1 120 === Second read: Adapter ada1 === Sequence: AAACGAGTTTTAATGACTCCAACTTAAGTGTATGTAAACTTCCGACTTCAACTGTA; Type: regular 5'; Length: 56; Trimmed: 3578937 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-56 bp: 5 Overview of removed sequences length count expect max.err error counts 21 5 0.0 2 5 49 5 0.0 4 0 0 0 1 0 4 50 85 0.0 5 1 0 0 1 5 78 51 2670 0.0 5 1 0 6 3 127 2533 52 140330 0.0 5 13 31 51 195 9213 130827 53 12205 0.0 5 39 253 1323 3942 5219 1429 54 94845 0.0 5 1124 7003 29601 49045 5953 2119 55 336144 0.0 5 31022 259913 25860 15011 2244 2094 56 2863637 0.0 5 2544109 263582 25817 8248 8030 13851 57 43801 0.0 5 7329 26023 2787 1789 4686 1187 58 57592 0.0 5 36 109 5080 45265 4867 2235 59 21301 0.0 5 0 3 12 1115 17423 2748 60 3697 0.0 5 1 0 0 6 2773 917 61 2609 0.0 5 0 0 0 0 9 2600 62 10 0.0 5 0 0 0 0 1 9 125 1 0.0 5 0 0 0 1 === Second read: Adapter ada2 === Sequence: ATGTCAGGAATTGTGAAAAAGTGAGTTTAAATGTATTTGGCTAAGGTGTATGTAAACTTCCGACTTCAACTGTA; Type: regular 5'; Length: 74; Trimmed: 4 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-59 bp: 5; 60-69 bp: 6; 70-74 bp: 7 Overview of removed sequences length count expect max.err error counts 56 2 0.0 5 0 0 1 1 74 1 0.0 7 1 122 1 0.0 7 1