This is cutadapt 5.1 with Python 3.12.5
Command line parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGCTGAATGTAATTGCGCATACCATAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -m 70 -o FilteredReads/R1.trim.fq.gz -p FilteredReads/R2.trim.fq.gz RawReads/LT2G2D_L01_R1.fq.gz RawReads/LT2G2D_L01_R2.fq.gz --report=full
Processing paired-end reads on 1 core ...

=== Summary ===

Total read pairs processed:              1,986
  Read 1 with adapter:                     226 (11.4%)
  Read 2 with adapter:                     362 (18.2%)

== Read fate breakdown ==
Pairs that were too short:                 153 (7.7%)
Pairs written (passing filters):         1,833 (92.3%)

Total basepairs processed:       595,800 bp
  Read 1:       297,900 bp
  Read 2:       297,900 bp
Total written (filtered):        545,240 bp (91.5%)
  Read 1:       273,566 bp
  Read 2:       271,674 bp

=== First read: Adapter 1 ===

Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA; Type: regular 3'; Length: 33; Trimmed: 226 times

Minimum overlap: 3
No. of allowed errors:
1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-33 bp: 3

Bases preceding removed adapters:
  A: 6.6%
  C: 65.5%
  G: 15.0%
  T: 12.8%
  none/other: 0.0%

Overview of removed sequences
length	count	expect	max.err	error counts
3	19	31.0	0	19
4	17	7.8	0	17
12	6	0.0	1	4 2
14	1	0.0	1	1
16	3	0.0	1	2 1
20	1	0.0	2	1
21	4	0.0	2	4
22	1	0.0	2	1
27	2	0.0	2	2
29	4	0.0	2	3 1
38	4	0.0	3	4
41	2	0.0	3	1 1
43	1	0.0	3	1
50	6	0.0	3	5 1
51	2	0.0	3	2
56	4	0.0	3	4
57	6	0.0	3	3 3
59	8	0.0	3	8
60	1	0.0	3	1
61	3	0.0	3	1 2
68	7	0.0	3	7
69	4	0.0	3	4
70	10	0.0	3	9 1
71	15	0.0	3	14 1
72	1	0.0	3	1
73	3	0.0	3	2 0 1
74	1	0.0	3	0 0 1
75	2	0.0	3	2
76	8	0.0	3	8
78	2	0.0	3	2
79	1	0.0	3	1
80	1	0.0	3	1
90	1	0.0	3	0 0 0 1
95	2	0.0	3	1 1
98	1	0.0	3	1
126	23	0.0	3	14 8 1
127	25	0.0	3	2 14 8 1
128	4	0.0	3	1 3
129	19	0.0	3	9 9 1
130	1	0.0	3	1


=== Second read: Adapter 2 ===

Sequence: AGCTGAATGTAATTGCGCATACCATAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT; Type: regular 3'; Length: 58; Trimmed: 299 times

Minimum overlap: 3
No. of allowed errors:
1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-58 bp: 5

Bases preceding removed adapters:
  A: 16.1%
  C: 41.8%
  G: 26.8%
  T: 3.3%
  none/other: 12.0%

Overview of removed sequences
length	count	expect	max.err	error counts
3	68	31.0	0	68
4	34	7.8	0	34
5	10	1.9	0	10
12	8	0.0	1	8
14	13	0.0	1	13
16	6	0.0	1	0 6
20	2	0.0	2	2
27	4	0.0	2	4
36	1	0.0	3	0 1
37	6	0.0	3	0 5 1
39	1	0.0	3	1
41	3	0.0	4	3
45	1	0.0	4	1
46	4	0.0	4	1 2 1
47	1	0.0	4	1
52	2	0.0	5	0 2
54	4	0.0	5	3 1
63	4	0.0	5	4
65	2	0.0	5	0 2
68	1	0.0	5	0 1
75	8	0.0	5	5 3
79	1	0.0	5	0 1
81	4	0.0	5	0 4
82	6	0.0	5	3 3
84	9	0.0	5	1 5 2 1
85	3	0.0	5	0 1 2
92	2	0.0	5	0 0 2
93	8	0.0	5	4 4
94	1	0.0	5	1
95	10	0.0	5	7 2 1
96	15	0.0	5	0 11 4
97	1	0.0	5	0 1
98	4	0.0	5	0 2 2
100	2	0.0	5	0 1 1
101	7	0.0	5	0 6 1
103	2	0.0	5	2
104	2	0.0	5	0 2
120	2	0.0	5	2
123	1	0.0	5	0 0 1
150	36	0.0	5	0 12 4 2 11 7


=== Second read: Adapter 3 ===

Sequence: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT; Type: regular 3'; Length: 33; Trimmed: 63 times

Minimum overlap: 3
No. of allowed errors:
1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-33 bp: 3

Bases preceding removed adapters:
  A: 12.7%
  C: 1.6%
  G: 81.0%
  T: 4.8%
  none/other: 0.0%
WARNING:
    The adapter is preceded by 'G' extremely often.
    The provided adapter sequence could be incomplete at its 5' end.
    Ignore this warning when trimming primers.

Overview of removed sequences
length	count	expect	max.err	error counts
3	56	31.0	0	56
4	1	7.8	0	1
16	1	0.0	1	1
28	1	0.0	2	1
33	1	0.0	3	0 1
102	1	0.0	3	1
129	1	0.0	3	0 0 1
130	1	0.0	3	0 1


WARNING:
    One or more of your adapter sequences may be incomplete.
    Please see the detailed output above.