This is cutadapt 5.1 with Python 3.12.5 Command line parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGCTGAATGTAATTGCGCATACCATAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -m 70 -o FilteredReads/R1.trim.fq.gz -p FilteredReads/R2.trim.fq.gz RawReads/LT2G2G_L01_R1.fq.gz RawReads/LT2G2G_L01_R2.fq.gz --report=full Processing paired-end reads on 1 core ... === Summary === Total read pairs processed: 1,616 Read 1 with adapter: 100 (6.2%) Read 2 with adapter: 188 (11.6%) == Read fate breakdown == Pairs that were too short: 30 (1.9%) Pairs written (passing filters): 1,586 (98.1%) Total basepairs processed: 484,800 bp Read 1: 242,400 bp Read 2: 242,400 bp Total written (filtered): 473,007 bp (97.6%) Read 1: 237,038 bp Read 2: 235,969 bp === First read: Adapter 1 === Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA; Type: regular 3'; Length: 33; Trimmed: 100 times Minimum overlap: 3 No. of allowed errors: 1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-33 bp: 3 Bases preceding removed adapters: A: 5.0% C: 32.0% G: 59.0% T: 4.0% none/other: 0.0% Overview of removed sequences length count expect max.err error counts 3 51 25.2 0 51 6 1 0.4 0 1 9 2 0.0 0 2 17 2 0.0 1 2 18 1 0.0 1 1 19 1 0.0 1 1 22 1 0.0 2 1 27 2 0.0 2 2 29 2 0.0 2 2 35 1 0.0 3 1 40 1 0.0 3 1 46 2 0.0 3 2 47 1 0.0 3 0 0 1 50 1 0.0 3 1 54 4 0.0 3 2 0 1 1 64 1 0.0 3 1 75 1 0.0 3 1 77 1 0.0 3 1 80 5 0.0 3 4 0 1 81 1 0.0 3 1 100 1 0.0 3 1 104 1 0.0 3 0 1 121 2 0.0 3 2 126 5 0.0 3 1 3 1 127 6 0.0 3 0 2 3 1 129 3 0.0 3 1 1 0 1 === Second read: Adapter 2 === Sequence: AGCTGAATGTAATTGCGCATACCATAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT; Type: regular 3'; Length: 58; Trimmed: 56 times Minimum overlap: 3 No. of allowed errors: 1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4; 50-58 bp: 5 Bases preceding removed adapters: A: 8.9% C: 57.1% G: 8.9% T: 19.6% none/other: 5.4% Overview of removed sequences length count expect max.err error counts 3 7 25.2 0 7 4 2 6.3 0 2 9 1 0.0 0 1 18 1 0.0 1 1 22 3 0.0 2 3 26 1 0.0 2 1 31 1 0.0 3 1 34 2 0.0 3 1 1 42 2 0.0 4 2 43 1 0.0 4 1 44 1 0.0 4 1 46 1 0.0 4 0 1 52 2 0.0 5 2 54 2 0.0 5 0 2 58 1 0.0 5 0 0 1 65 1 0.0 5 0 1 71 2 0.0 5 2 75 1 0.0 5 1 79 6 0.0 5 4 1 0 0 1 81 1 0.0 5 1 82 1 0.0 5 1 89 1 0.0 5 0 1 99 1 0.0 5 0 1 102 1 0.0 5 1 105 6 0.0 5 4 2 125 1 0.0 5 1 129 1 0.0 5 0 0 1 146 2 0.0 5 0 2 150 3 0.0 5 0 1 0 0 2 === Second read: Adapter 3 === Sequence: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT; Type: regular 3'; Length: 33; Trimmed: 132 times Minimum overlap: 3 No. of allowed errors: 1-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-33 bp: 3 Bases preceding removed adapters: A: 0.8% C: 2.3% G: 93.9% T: 3.0% none/other: 0.0% WARNING: The adapter is preceded by 'G' extremely often. The provided adapter sequence could be incomplete at its 5' end. Ignore this warning when trimming primers. Overview of removed sequences length count expect max.err error counts 3 128 25.2 0 128 4 1 6.3 0 1 9 1 0.0 0 1 47 1 0.0 3 0 1 105 1 0.0 3 1 WARNING: One or more of your adapter sequences may be incomplete. Please see the detailed output above.